si:ch211-121b5.4

Ensembl ID:
ENSDARG00000013524
ZFIN ID:
ZDB-GENE-090312-107
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa502 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035654 Nonsense 387 497 7 9
Genomic Location (Zv9):
Chromosome 23 (position 42655901)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42695058
KASP Assay ID:
554-0220.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTACCTTTACGCCTCCCAGAGTGGCCAACAAGGACACGACAGTGGGA[G/T]GACAGCTCATCCCAAAGGTGATTGCATCCCTGTGTTGTGTAACAAAGACT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link