ube2k

Ensembl ID:
ENSDARG00000013505
ZFIN ID:
ZDB-GENE-980605-9
Description:
ubiquitin-conjugating enzyme E2 K [Source:RefSeq peptide;Acc:NP_001008611]
Human Orthologue:
UBE2K
Human Description:
ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) [Source:HGNC Symbol;Acc:4914]
Mouse Orthologue:
Ube2k
Mouse Description:
ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene [Source:MGI Symbol;Acc:MGI:1858216]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17882 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025770 Essential Splice Site 100 200 4 8
ENSDART00000139003 Essential Splice Site 100 200 4 7
Genomic Location:
Chromosome 1 (position 22089776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAGTTCTGTTACCGGGGCGATATGTTTGGACATTTTAAAAGACCAGTG[G/A]TGAGTGCTTCATTATCATGACTCATCATTTAATTTAATGGTTCAACTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1ppjc9zt