abca2

Ensembl ID:
ENSDARG00000013500
ZFIN ID:
ZDB-GENE-050517-1
Description:
Novel protein similar to vertebrate ATP-binding cassette sub-family A ABC1 member 2 (ABCA2) [Source:
Human Orthologue:
ABCA2
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 2 [Source:HGNC Symbol;Acc:32]
Mouse Orthologue:
Abca2
Mouse Description:
ATP-binding cassette, sub-family A (ABC1), member 2 Gene [Source:MGI Symbol;Acc:MGI:99606]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40425 Nonsense Mutation detected in F1 DNA During 2016
sa9569 Nonsense Available for shipment Available now
sa33597 Nonsense Mutation detected in F1 DNA During 2016
sa33596 Nonsense Mutation detected in F1 DNA During 2016
sa40424 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18415 Nonsense Available for shipment Available now
sa40423 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Nonsense 141 2503 4 49
ENSDART00000141554 Nonsense 119 2418 3 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26832807)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24660072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCACCTCGAAAGTCTGAGCTCAGCACAAGGCCCTCTAGAGAGCCACTA[C/A]AACACCAGCCACGGTCAGAAAATGCACAGACATACTAAACATGCAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Nonsense 312 2503 8 49
ENSDART00000141554 Nonsense 231 2418 6 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26816663)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24643928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTGGGGAAGGAGGGAACAGTGAGATTGGCAAAATCCTATTGGTCCCT[G/T]AGAAACAACAGGYGGTTTTACAGGCYTACYGCACGACTGTTTGTGGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Nonsense 569 2503 11 49
ENSDART00000141554 Nonsense 484 2418 9 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26810601)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24637866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGGGCCTTTTTAGAGGAGGGTAAATTGCAAAATCACCTGATGTGGCTC[C/T]AGCAGGTAACACCCTTTCTTTCAGTCACTAATCTAAAAGTATTTGGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Nonsense 676 2503 14 49
ENSDART00000141554 Nonsense 591 2418 12 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26807193)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24634458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATTTTCCAGACCAATAAAGATGGATCCCTGCCACCCCATGTTATGTA[T/G]AAAATTCGACAGAACTCGAGCTTTACCGAGAAAACCAATGAAATCCGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Essential Splice Site 853 2503 17 49
ENSDART00000141554 Essential Splice Site 768 2418 15 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26800994)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24628259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATATGGCTTTTTCTTACAATCTACGCTGTCGCAACCATCATGTTCTGG[T/C]ACTGAAGTGTGCAATAAGTCACATTTAGTTCTGTCGCTGTGTATTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Nonsense 1561 2503 29 49
ENSDART00000141554 Nonsense 1476 2418 27 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26785724)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24612989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGGTGACCTTCCTCCCCTGATCCTGTCTCCATCTCAATATCACAACTA[C/A]ACACAGCCTCGAGGAAACWTCATCCCCTACGCCAATGAAGACAGATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Essential Splice Site 2376 2503 46 49
ENSDART00000141554 Essential Splice Site 2291 2418 44 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26765086)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24592351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGTGATTCGGTTTTTTAACAGAAATTTTCCTGAGGCAATTCTAAAG[G/A]TGAGATTAGGTTAGATTAGGTTATGTTTTAGATCTGTATTTTCTGTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link