abca2

Ensembl ID:
ENSDARG00000013500
ZFIN ID:
ZDB-GENE-050517-1
Description:
Novel protein similar to vertebrate ATP-binding cassette sub-family A ABC1 member 2 (ABCA2) [Source:
Human Orthologue:
ABCA2
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 2 [Source:HGNC Symbol;Acc:32]
Mouse Orthologue:
Abca2
Mouse Description:
ATP-binding cassette, sub-family A (ABC1), member 2 Gene [Source:MGI Symbol;Acc:MGI:99606]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9569 Nonsense Available for shipment Available now
sa18415 Nonsense Available for shipment Available now
sa3552 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Nonsense 312 2503 8 49
ENSDART00000141554 Nonsense 231 2418 6 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26816663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTGGGGAAGGAGGGAACAGTGAGATTGGCAAAATCCTATTGGTCCCT[G/T]AGAAACAACAGGYGGTTTTACAGGCYTACYGCACGACTGTTTGTGGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Nonsense 1561 2503 29 49
ENSDART00000141554 Nonsense 1476 2418 27 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26785724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGGTGACCTTCCTCCCCTGATCCTGTCTCCATCTCAATATCACAACTA[C/A]ACACAGCCTCGAGGAAACWTCATCCCCTACGCCAATGAAGACAGATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090743 Essential Splice Site 2422 2503 47 49
ENSDART00000141554 Essential Splice Site 2337 2418 45 47

The following transcripts of ENSDARG00000013500 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26763101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGCTGAGCATCGAGGATTATTCCGTCAGCCAAACCACACTGGATAAC[G/A]TAAGTAAACCTCGAGAAATAATACTAGTTTAAAAAGTCATCAAAGTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4areyc3d