map3k9

Ensembl ID:
ENSDARG00000013491
ZFIN ID:
ZDB-GENE-081113-5
Description:
Novel protein similar to H.sapiens MAP3K9, mitogen-activated protein kinase kinase kinase 9 (MAP3K9)
Human Orthologue:
MAP3K9
Human Description:
mitogen-activated protein kinase kinase kinase 9 [Source:HGNC Symbol;Acc:6861]
Mouse Orthologue:
Map3k9
Mouse Description:
mitogen-activated protein kinase kinase kinase 9 Gene [Source:MGI Symbol;Acc:MGI:2449952]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12907 Nonsense Available for shipment Available now
sa35552 Nonsense Mutation detected in F1 DNA During 2016
sa35551 Nonsense Mutation detected in F1 DNA During 2016
sa31945 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057185 Nonsense 131 1024 1 11
ENSDART00000146522 Nonsense 119 554 1 7
Genomic Location:
Chromosome 13 (position 36585672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGYAACGGAATCTCGGAGAAGATCCGGGACACGCCGGAGGACTATTG[C/A]GACTATTCGGTGCCACCGTTACACTGTGAGTACGCTGAYCRCATCTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057185 Nonsense 345 1024 4 11
ENSDART00000146522 Nonsense 333 554 4 7
Genomic Location:
Chromosome 13 (position 36572291)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTCTGTCTGTCTGTCTTTTTCTCTCAGTTACGGGGTTTTGTTGTGG[G/T]AGCTGCTGACAGGAGAGGTGCCGTTTCGTGGTATTGACGGTCTGGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057185 Nonsense 508 1024 6 11
ENSDART00000146522 Nonsense 493 554 6 7
Genomic Location:
Chromosome 13 (position 36567594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACGTCATCATTCACCAGCTGTACCAGGAGAAACCACGAGTGCAGCAC[C/T]GACACGGAAAGTTCCGGCGCAGTCGACTTAAACTGCGGGATGGGAACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057185 Nonsense 992 1024 11 11
ENSDART00000146522   None 554 None 7
Genomic Location:
Chromosome 13 (position 36561733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAATGGAGCAGCCAACCCCCTGTTCCCCTTGGGTGAATGACAGTCTTT[T/A]GGACCAACAGGATGAAGGCCAATACAAGGATGGGACACGACCACTCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link