map3k9

Ensembl ID:
ENSDARG00000013491
ZFIN ID:
ZDB-GENE-081113-5
Description:
Novel protein similar to H.sapiens MAP3K9, mitogen-activated protein kinase kinase kinase 9 (MAP3K9)
Human Orthologue:
MAP3K9
Human Description:
mitogen-activated protein kinase kinase kinase 9 [Source:HGNC Symbol;Acc:6861]
Mouse Orthologue:
Map3k9
Mouse Description:
mitogen-activated protein kinase kinase kinase 9 Gene [Source:MGI Symbol;Acc:MGI:2449952]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12907 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057185 Nonsense 131 1024 1 11
ENSDART00000146522 Nonsense 119 554 1 7
Genomic Location:
Chromosome 13 (position 36585672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGYAACGGAATCTCGGAGAAGATCCGGGACACGCCGGAGGACTATTG[C/A]GACTATTCGGTGCCACCGTTACACTGTGAGTACGCTGAYCRCATCTACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eikg71dh