gga3

Ensembl ID:
ENSDARG00000013479
ZFIN ID:
ZDB-GENE-041111-218
Description:
golgi associated, gamma adaptin ear containing, ARF binding protein 3 [Source:RefSeq peptide;Acc:NP
Human Orthologue:
GGA3
Human Description:
golgi-associated, gamma adaptin ear containing, ARF binding protein 3 [Source:HGNC Symbol;Acc:17079]
Mouse Orthologue:
Gga3
Mouse Description:
golgi associated, gamma adaptin ear containing, ARF binding protein 3 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2325 Nonsense F2 line generated During 2014
sa20678 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2325
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102986 Nonsense 443 699 13 17
ENSDART00000121692 Nonsense 443 691 13 18
ENSDART00000137144 Nonsense 446 702 13 17
Genomic Location:
Chromosome 6 (position 18674441)
KASP Assay ID:
554-3358.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAYAGATTTCAAAWCCAGTGACTGACTTCCTCTGCAGCTCTACTMCCT[T/G]AAATCCTCCTAACTCWGCAGCACCACCTACATCTAAAACTACCTCRATMA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102986 Essential Splice Site 570 699 None 17
ENSDART00000121692 Essential Splice Site 562 691 None 18
ENSDART00000137144 Essential Splice Site 573 702 None 17
Genomic Location:
Chromosome 6 (position 18675167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATCTCCCTAACCAGCGTCTTTGTCCCGCTGGAGGCCATTAAACCAAG[T/A]AAGTCCAATAATAAATGTGGATGCTGTTGGTAGAAAGGATGCTGTATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0e2u0ud7