gata1a

Ensembl ID:
ENSDARG00000013477
ZFIN ID:
ZDB-GENE-980526-268
Description:
GATA binding protein 1a [Source:RefSeq peptide;Acc:NP_571309]
Human Orthologue:
GATA1
Human Description:
GATA binding protein 1 (globin transcription factor 1) [Source:HGNC Symbol;Acc:4170]
Mouse Orthologue:
Gata1
Mouse Description:
GATA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:95661]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1048 Essential Splice Site F2 line generated During 2014
sa18633 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1048
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013714 Essential Splice Site None 418 1 6
ENSDART00000112362 None None 418 None 5

The following transcripts of ENSDARG00000013477 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 26352323)
KASP Assay ID:
554-0951.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAATCTCCTGATACTGATAAACGACATCTTCAATACTACACTTGCAGG[T/C]AAGTTCATAAATACGGTGTCAGTAAAAAGTGTCTAACAACACATGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013714 Essential Splice Site 282 418 4 6
ENSDART00000112362 Essential Splice Site 282 418 3 5

The following transcripts of ENSDARG00000013477 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 26348062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAGATGAACGGCCAGAACAGACCCCTYATCAGACCAAAAAAGAGGCTG[G/A]TWTGTAAAATGAAWACAAAACTTAATGTTAAACTAWGGTAAATATAGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zpndpz0x