nedd1

Ensembl ID:
ENSDARG00000013472
ZFIN ID:
ZDB-GENE-040426-2906
Description:
protein NEDD1 [Source:RefSeq peptide;Acc:NP_998671]
Human Orthologue:
NEDD1
Human Description:
neural precursor cell expressed, developmentally down-regulated 1 [Source:HGNC Symbol;Acc:7723]
Mouse Orthologue:
Nedd1
Mouse Description:
neural precursor cell expressed, developmentally down-regulated gene 1 Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24660 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027740 Essential Splice Site 77 677 3 17
ENSDART00000141056 Essential Splice Site 77 675 3 17

The following transcripts of ENSDARG00000013472 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20034665)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19446642
KASP Assay ID:
554-7127.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCAGTCTCAAGTCCTCTCCTGTTCCAGTCATGGAGCTCGGTGAAGGG[G/A]TGAGCTGACAAACTAAATATCTTAACTCAACATATCTTTCTTATTGATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link