si:dkey-15f17.9

Ensembl ID:
ENSDARG00000013453
ZFIN ID:
ZDB-GENE-090313-193
Description:
Putative ATP-dependent RNA helicase TDRD9 [Source:UniProtKB/Swiss-Prot;Acc:B8A4F4]
Human Orthologue:
TDRD9
Human Description:
tudor domain containing 9 [Source:HGNC Symbol;Acc:20122]
Mouse Orthologue:
Tdrd9
Mouse Description:
tudor domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:1921941]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2676 Nonsense F2 line generated During 2017
sa17024 Essential Splice Site Available for shipment Available now
sa22335 Nonsense Available for shipment Available now
sa38952 Nonsense Mutation detected in F1 DNA During 2017
sa35527 Splice Site, Nonsense Available for shipment Available now
sa4512 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2676
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Nonsense 84 1342 3 35
ENSDART00000124958 Nonsense 84 1344 3 35
Genomic Location (Zv9):
Chromosome 13 (position 31628674)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31274622
KASP Assay ID:
554-2480.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCTTTGATTTATAGGTCCAGGAACAAGCCCTCCTTCACTGGCCAGTTA[T/A]GAGTATCCAATTCTACCAATTACTAAGAACAGACAAGAGGTACTGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Essential Splice Site 171 1342 4 35
ENSDART00000124958 Essential Splice Site 171 1344 4 35
Genomic Location (Zv9):
Chromosome 13 (position 31629067)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31275015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGGCACGTGAGCGCAAATGTACTCTGGGAAGCTTGGTGGGGTATCAGG[T/A]GTGAGATGCATGGCATACAATCTCTTTTCCATAACAGTATGAAAATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Nonsense 495 1342 14 35
ENSDART00000124958 Nonsense 497 1344 14 35
Genomic Location (Zv9):
Chromosome 13 (position 31633014)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31278962
KASP Assay ID:
2260-6604.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGATTTGAATTGCAGCGGTCACCGTTGGCCAGTACCTTGT[T/A]GAAGGTAAAGTTGTTGGATATGGGGGATCCTCGCTCGGTTCTCTCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Nonsense 746 1342 22 35
ENSDART00000124958 Nonsense 748 1344 22 35
Genomic Location (Zv9):
Chromosome 13 (position 31637594)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31283542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTTCTCTCTCAGATTCGGAATTTGCCTCCGTTTGCATTCCTGTGCTA[T/A]AAGCAGCTGCAGTCACTGTTTCGTCAATGTGGACAGGTCAAGTCAATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Splice Site, Nonsense 863 1342 24 35
ENSDART00000124958 Splice Site, Nonsense 865 1344 24 35
Genomic Location (Zv9):
Chromosome 13 (position 31638247)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31284195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATCCCGAGAAACTTCCAACCAGCCGAGATTTCGTCATCAACATTACT[G/T]AGGTGAAAATACTACACATGAAAGTCCTCTCAAATAGGCTTAACCACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4512
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Nonsense 1222 1342 32 35
ENSDART00000124958 Nonsense 1224 1344 32 35
Genomic Location (Zv9):
Chromosome 13 (position 31644902)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31290850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCTGCTTTACTGGAGCTCTGTGTGGACTGGGCTGGAACTCTGTTTCC[C/T]AAGAGGCAGTGCTTCCTGAACATGACATTGAGATTGCATTTGACGTCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link