hey2

Ensembl ID:
ENSDARG00000013441
ZFIN ID:
ZDB-GENE-000526-1
Description:
Hairy/enhancer-of-split related with YRPW motif protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q9I9L0]
Human Orthologue:
HEY2
Human Description:
hairy/enhancer-of-split related with YRPW motif 2 [Source:HGNC Symbol;Acc:4881]
Mouse Orthologue:
Hey2
Mouse Description:
hairy/enhancer-of-split related with YRPW motif 2 Gene [Source:MGI Symbol;Acc:MGI:1341884]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10785 Essential Splice Site Available for shipment Available now
sa16273 Nonsense Available for shipment Available now
sa23783 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023531 Essential Splice Site 110 324 4 5
Genomic Location:
Chromosome 20 (position 39618881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGACAGTGGATCATCTGAAGATGCTTCAGGCCACAGGAGGAAAAGG[T/C]AGRCCGCATGTTATTGGCTCACCACCTAAWGCTGTAGTGAAATCTGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023531 Nonsense 136 324 5 5
Genomic Location:
Chromosome 20 (position 39615842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTCTTGAGCATCGGCTTCCGGGAGTGTCTGACTGAAGTGGCCAGGTA[T/G]TTGAGCTCTGTGGAAGGCCTGGACTCCAGCGACCCTCTCCGTGTCCGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023531 Nonsense 201 324 5 5
Genomic Location:
Chromosome 20 (position 39615649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGGCTGCCGCTTTGCATCCCATTCCTGCTGCGTTCCTGCAGCAGAGC[G/T]GACTTCCCTCCTCAGAGAGCTCCTCCGGCAGGCTGTCTGAGGCTCCTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r8nbeyyd