Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hira
- Ensembl ID:
- ENSDARG00000013434
- ZFIN ID:
- ZDB-GENE-030131-6296
- Description:
- Novel protein similar to vertebrate HIR histone cell cycle regulation defective homolog A (S. cerevi
- Human Orthologue:
- HIRA
- Human Description:
- HIR histone cell cycle regulation defective homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:4916]
- Mouse Orthologue:
- Hira
- Mouse Description:
- histone cell cycle regulation defective homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:99
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa40382 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa33557 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40382
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000006215 | Essential Splice Site | 371 | 993 | 11 | 26 |
| ENSDART00000132164 | Essential Splice Site | 371 | 1010 | 11 | 25 |
The following transcripts of ENSDARG00000013434 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 19652146)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 17552119 GRCz11 5 18056115 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGACTTCTCGCAGGATGAACTGGGAGACCCCTTGAATGAAGAGGAAAAG[G/A]TGGAGAAAAAGCACACAAACCAGAGTTGAACACTTAGAGTTAGTGTAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33557
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000006215 | Nonsense | 562 | 993 | 15 | 26 |
| ENSDART00000132164 | Nonsense | 562 | 1010 | 15 | 25 |
The following transcripts of ENSDARG00000013434 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 19645313)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 17558952 GRCz11 5 18062948 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTGCTGACTTCTGCCTCCAAAATCGAGCCCATGAAAGCACTAGATTCA[C/T]GATTTACTGAAAGGTCAAAAGCCACACCAGGGGTCACTAGCGTACCCATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
