hira

Ensembl ID:
ENSDARG00000013434
ZFIN ID:
ZDB-GENE-030131-6296
Description:
Novel protein similar to vertebrate HIR histone cell cycle regulation defective homolog A (S. cerevi
Human Orthologue:
HIRA
Human Description:
HIR histone cell cycle regulation defective homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:4916]
Mouse Orthologue:
Hira
Mouse Description:
histone cell cycle regulation defective homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:99

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40382 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33557 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006215 Essential Splice Site 371 993 11 26
ENSDART00000132164 Essential Splice Site 371 1010 11 25

The following transcripts of ENSDARG00000013434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 19652146)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17552119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTTCTCGCAGGATGAACTGGGAGACCCCTTGAATGAAGAGGAAAAG[G/A]TGGAGAAAAAGCACACAAACCAGAGTTGAACACTTAGAGTTAGTGTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006215 Nonsense 562 993 15 26
ENSDART00000132164 Nonsense 562 1010 15 25

The following transcripts of ENSDARG00000013434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 19645313)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17558952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGCTGACTTCTGCCTCCAAAATCGAGCCCATGAAAGCACTAGATTCA[C/T]GATTTACTGAAAGGTCAAAAGCCACACCAGGGGTCACTAGCGTACCCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link