lmna

Ensembl ID:: ENSDARG00000013415
ZFIN ID:: ZDB-GENE-020424-3
Description:: prelamin-A/C [Source:RefSeq peptide;Acc:NP_694503]
Human Orthologue:: LMNA
Human Description:: lamin A/C [Source:HGNC Symbol;Acc:6636]
Mouse Orthologue:: Lmna
Mouse Description:: lamin A Gene [Source:MGI Symbol;Acc:MGI:96794]

Alleles

There are 3 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa13189	Nonsense	Available for shipment	Available now
sa10537	Nonsense	Available for shipment	Available now
sa22872	Essential Splice Site	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa13189
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000024919	Nonsense	8	659	1	12
ENSDART00000145087	Nonsense	8	659	2	13
ENSDART00000024919	Nonsense	8	659	1	12
ENSDART00000145087	Nonsense	8	659	2	13

The following transcripts of ENSDARG00000013415 do not overlap with this mutation:

Genomic Location:: Chromosome 16 (position 32866644)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TATTCTAGTATCAGTAGTTYCAGACAACCATGGAGACTCCAGGTCAGAAA[C/T]GAAGCAGCCGCGGTGGGGTGACCAATGTCCTGTCCCCYACCCGCATCTCT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa10537
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000024919	Nonsense	8	659	1	12
ENSDART00000145087	Nonsense	8	659	2	13
ENSDART00000024919	Nonsense	8	659	1	12
ENSDART00000145087	Nonsense	8	659	2	13

The following transcripts of ENSDARG00000013415 do not overlap with this mutation:

Genomic Location:: Chromosome 16 (position 32866644)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TATTCTAGTATCAGTAGTTYCAGACAACCATGGAGACTCCAGGTCAGAAA[C/T]GAAGCAGCCGCGGTGGGGTGACCAATGTCCTGTCCCCYACCCGCATCTCT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa22872
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000024919	Essential Splice Site	211	659	4	12
ENSDART00000145087	Essential Splice Site	211	659	5	13

The following transcripts of ENSDARG00000013415 do not overlap with this mutation:

Genomic Location:: Chromosome 16 (position 32839636)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: GTTTAAAGACATGCTAAATCTGATCTCGCTACTGTAACCTTTTTTCAACA[G/T]GAGCTCCGTGAGTCTAAGCGCAGATATGAGTCACGTGTGGTGGAGATTGA
Associated Phenotype:: Not determined

OMIM

More OMIM information for LMNA

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: