
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
lmna
- Ensembl ID:
- ENSDARG00000013415
- ZFIN ID:
- ZDB-GENE-020424-3
- Description:
- prelamin-A/C [Source:RefSeq peptide;Acc:NP_694503]
- Human Orthologue:
- LMNA
- Human Description:
- lamin A/C [Source:HGNC Symbol;Acc:6636]
- Mouse Orthologue:
- Lmna
- Mouse Description:
- lamin A Gene [Source:MGI Symbol;Acc:MGI:96794]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13189 | Nonsense | Available for shipment | Available now |
sa10537 | Nonsense | Available for shipment | Available now |
sa22872 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13189
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024919 | Nonsense | 8 | 659 | 1 | 12 |
ENSDART00000145087 | Nonsense | 8 | 659 | 2 | 13 |
ENSDART00000024919 | Nonsense | 8 | 659 | 1 | 12 |
ENSDART00000145087 | Nonsense | 8 | 659 | 2 | 13 |
The following transcripts of ENSDARG00000013415 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 32866644)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 30605159 GRCz11 16 30563086 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTCTAGTATCAGTAGTTYCAGACAACCATGGAGACTCCAGGTCAGAAA[C/T]GAAGCAGCCGCGGTGGGGTGACCAATGTCCTGTCCCCYACCCGCATCTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10537
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024919 | Nonsense | 8 | 659 | 1 | 12 |
ENSDART00000145087 | Nonsense | 8 | 659 | 2 | 13 |
ENSDART00000024919 | Nonsense | 8 | 659 | 1 | 12 |
ENSDART00000145087 | Nonsense | 8 | 659 | 2 | 13 |
The following transcripts of ENSDARG00000013415 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 32866644)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 30605159 GRCz11 16 30563086 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTCTAGTATCAGTAGTTYCAGACAACCATGGAGACTCCAGGTCAGAAA[C/T]GAAGCAGCCGCGGTGGGGTGACCAATGTCCTGTCCCCYACCCGCATCTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22872
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024919 | Essential Splice Site | 211 | 659 | 4 | 12 |
ENSDART00000145087 | Essential Splice Site | 211 | 659 | 5 | 13 |
The following transcripts of ENSDARG00000013415 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 32839636)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 30578151 GRCz11 16 30536078 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTAAAGACATGCTAAATCTGATCTCGCTACTGTAACCTTTTTTCAACA[G/T]GAGCTCCGTGAGTCTAAGCGCAGATATGAGTCACGTGTGGTGGAGATTGA
- Associated Phenotype:
- Not determined
OMIM
- Cardiomyopathy, dilated, 1A
- Charcot-Marie-Tooth disease, type 2B1
- Emery-Dreifuss muscular dystrophy 2, AD
- Emery-Dreifuss muscular dystrophy 3, AR
- Heart-hand syndrome, Slovenian type
- Hutchinson-Gilford progeria
- Lipodystrophy, familial partial, 2
- Malouf syndrome
- Mandibuloacral dysplasia
- Muscular dystrophy, congenital
- Muscular dystrophy, limb-girdle, type 1B
- Restrictive dermopathy, lethal
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: