guca1b

Ensembl ID:
ENSDARG00000013393
ZFIN ID:
ZDB-GENE-011128-6
Description:
guanylyl cyclase-activating protein 2 [Source:RefSeq peptide;Acc:NP_571946]
Human Orthologue:
GUCA1B
Human Description:
guanylate cyclase activator 1B (retina) [Source:HGNC Symbol;Acc:4679]
Mouse Orthologue:
Guca1b
Mouse Description:
guanylate cyclase activator 1B Gene [Source:MGI Symbol;Acc:MGI:1194489]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7502 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007122 Missense 73 197 2 4
Genomic Location (Zv9):
Chromosome 23 (position 19518429)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19303536
KASP Assay ID:
554-4099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACCTGAGATTTTCTTTTTCTTTGTTAMAGGACAATACTATTGATTT[T/A]CTGGAATACGTGGCGGCCTTGAATCTAGTGCTGCGAGGGAAGTTGGAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link