ppp6r3

Ensembl ID:
ENSDARG00000013379
ZFIN ID:
ZDB-GENE-030131-3251
Description:
protein phosphatase 6, regulatory subunit 3 [Source:RefSeq peptide;Acc:NP_955978]
Human Orthologue:
PPP6R3
Human Description:
protein phosphatase 6, regulatory subunit 3 [Source:HGNC Symbol;Acc:1173]
Mouse Orthologue:
Ppp6r3
Mouse Description:
protein phosphatase 6, regulatory subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1921807]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16892 Nonsense Available for shipment Available now
sa18514 Essential Splice Site Available for shipment Available now
sa38016 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021497 Nonsense 111 396 4 12
ENSDART00000129682 Nonsense 111 902 2 23
Genomic Location (Zv9):
Chromosome 25 (position 10832760)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10524811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGGCTGGGTGAAGATGAAAGTTTACTGATGAAACTCTACAGCTTCYTA[C/T]AGAACGAGCCTCCGCTCAACCCACTGCTGGCCAGTTTCTTCAGCAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021497   None 396 None 12
ENSDART00000129682 Essential Splice Site 451 902 10 23
Genomic Location (Zv9):
Chromosome 25 (position 10826388)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10518439
KASP Assay ID:
2261-9428.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTAATACAAAGAATTCTTGATGCCTGGGGWWCAAACGACAARGAGCAG[T/C]GAGTAACTCTTAAATCTGATYGGTCKGTTATGTTTAATTTAAAAGGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021497   None 396 None 12
ENSDART00000129682 Nonsense 759 902 19 23
Genomic Location (Zv9):
Chromosome 25 (position 10820966)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10513017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCATAGAGACGGTGGACCCTCTGGGAGTCAATGCGCCTATGCAGCAA[G/T]AAAGTAAGAATAGACTCTTACCATCCTCATTTCAATTTCGACACACACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link