fem1c

Ensembl ID:
ENSDARG00000013375
ZFIN ID:
ZDB-GENE-031008-3
Description:
Protein fem-1 homolog C [Source:UniProtKB/Swiss-Prot;Acc:Q7T3P8]
Human Orthologue:
FEM1A
Human Description:
fem-1 homolog a (C. elegans) [Source:HGNC Symbol;Acc:16934]
Mouse Orthologues:
4931440F15Rik, Fem1a
Mouse Descriptions:
feminization 1 homolog a (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1335089]
RIKEN cDNA 4931440F15 gene Gene [Source:MGI Symbol;Acc:MGI:2441689]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30897 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017718 Nonsense 368 618 5 5
Genomic Location (Zv9):
Chromosome 8 (position 460792)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 424698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACTTCGAGCGCTGCATCCGGCTGTGGAAGTACGCGCTGGACATGCAG[C/T]AGAGCAACCTGGAGCCGCTGAGCCCCATGACCGCCAGCAGCCTGCTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link