cirbp

Ensembl ID:
ENSDARG00000013351
ZFIN ID:
ZDB-GENE-030131-5841
Description:
cold inducible RNA binding protein isoform 1 [Source:RefSeq peptide;Acc:NP_001035411]
Human Orthologues:
CIRBP, RBM3
Human Descriptions:
cold inducible RNA binding protein [Source:HGNC Symbol;Acc:1982]
RNA binding motif (RNP1, RRM) protein 3 [Source:HGNC Symbol;Acc:9900]
Mouse Orthologues:
Cirbp, Rbm3
Mouse Descriptions:
cold inducible RNA binding protein Gene [Source:MGI Symbol;Acc:MGI:893588]
RNA binding motif protein 3 Gene [Source:MGI Symbol;Acc:MGI:1099460]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24148 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105404 Nonsense 36 220 2 7
ENSDART00000105405 Nonsense 37 224 2 7
ENSDART00000126287 Nonsense 19 195 2 8
ENSDART00000132156 None None 55 None 2

The following transcripts of ENSDARG00000013351 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 18769626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACGAGGGAAAGCTTTTCATCGGTGGTCTGAGCTATGATACAACAGAA[C/T]AGTCCTTGGAGGAAGCATTCTCCAAATATGGAACCATTGCCAAAGGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/86e78bc3