si:ch73-289a15.2

Ensembl ID:
ENSDARG00000013346
ZFIN ID:
ZDB-GENE-090311-29
Human Orthologue:
C3orf63
Human Description:
chromosome 3 open reading frame 63 [Source:HGNC Symbol;Acc:30314]
Mouse Orthologue:
D14Abb1e
Mouse Description:
DNA segment, Chr 14, Abbott 1 expressed Gene [Source:MGI Symbol;Acc:MGI:1921694]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12409 Nonsense Available for shipment Available now
sa17870 Nonsense Available for shipment Available now
sa24294 Essential Splice Site Available for shipment Available now
sa31086 Nonsense Mutation detected in F1 DNA During 2017
sa43946 Nonsense Mutation detected in F1 DNA During 2017
sa32438 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009092 Nonsense 286 1827 7 23
ENSDART00000137026 Nonsense 67 1608 4 20
Genomic Location (Zv9):
Chromosome 23 (position 19771647)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19556754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGTCCTGTTATTCTAATTGTTGTGTTTCATTMCAGCAATAYTTTTA[T/A]GAATTTGCATATGATGAGCTCAAGTCAAGGCCTAGACATGTGTTGCCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009092 Nonsense 436 1827 11 23
ENSDART00000137026 Nonsense 217 1608 8 20
Genomic Location (Zv9):
Chromosome 23 (position 19769885)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19554992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAACAGGAAAACAGCCWCACGGGACTGCTGCAACGGCTTGAGAGAGAA[A/T]GAATGGTGAGCTAATTCACACCCTGCTTTACGCWTTGATACAATTAATKC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009092 Essential Splice Site 437 1827 11 23
ENSDART00000137026 Essential Splice Site 218 1608 8 20
Genomic Location (Zv9):
Chromosome 23 (position 19769878)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19554985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAACAGCCTCACGGGACTGCTGCAACGGCTTGAGAGAGAAAGAATGG[T/C]GAGCTAATTCACACCCTGCTTTACGCTTTGATACAATTAATGCCTGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009092 Nonsense 486 1827 13 23
ENSDART00000137026 Nonsense 267 1608 10 20
ENSDART00000009092 Nonsense 486 1827 13 23
ENSDART00000137026 Nonsense 267 1608 10 20
Genomic Location (Zv9):
Chromosome 23 (position 19769456)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19554563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTACAGGCGCTTTTTATCTTTCAAGAGCAAAGAAGCATCTCGAAGT[T/A]GAGTAAGTGCCTCTAATGTTTTTTTTCTCCCCACACTTACTTTAACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009092 Nonsense 486 1827 13 23
ENSDART00000137026 Nonsense 267 1608 10 20
ENSDART00000009092 Nonsense 486 1827 13 23
ENSDART00000137026 Nonsense 267 1608 10 20
Genomic Location (Zv9):
Chromosome 23 (position 19769456)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19554563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTACAGGCGCTTTTTATCTTTCAAGAGCAAAGAAGCATCTCGAAGT[T/A]GAGTAAGTGCCTCTAATGTTTTTTTTCTCCCCACACTTACTTTAACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009092 Nonsense 911 1827 17 23
ENSDART00000137026 Nonsense 692 1608 14 20
Genomic Location (Zv9):
Chromosome 23 (position 19767175)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19552282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGATGGAGGCACAGCATATAATCTACAACTCACAGCCTCCTTTGCCA[C/T]GAAATGAGGACCTGACCATACGATCCAGTCCCGCATTCTCACCTTTTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link