KIF26B

Ensembl ID:
ENSDARG00000013343
Description:
kinesin family member 26B [Source:HGNC Symbol;Acc:25484]
Human Orthologue:
KIF26B
Human Description:
kinesin family member 26B [Source:HGNC Symbol;Acc:25484]
Mouse Orthologue:
Kif26b
Mouse Description:
kinesin family member 26B Gene [Source:MGI Symbol;Acc:MGI:2447076]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23012 Nonsense Available for shipment Available now
sa11741 Nonsense Available for shipment Available now
sa36343 Nonsense Available for shipment Available now
sa12696 Nonsense Available for shipment Available now
sa16869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013170 Nonsense 560 2129 7 15
Genomic Location (Zv9):
Chromosome 17 (position 11547146)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11529668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACTGTGGCTGAGGTCATCCAGTCTGTGGTCAATGGAGCAGACGGCTG[T/A]GTGTTTTGCTTTGGACACTCCAAACTAGGTAAGAGAGAGAGAGGCTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013170 Nonsense 1665 2129 12 15
Genomic Location (Zv9):
Chromosome 17 (position 11572912)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11555434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTGAAGATATGRGTGGTAAACATAAAGGACCAAACGTAGAGAGCAGC[A/T]GACTCTTTAGTGCTAAACTTGAGCAGTTRGCWAACAGAACCAATTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013170 Nonsense 1694 2129 12 15
Genomic Location (Zv9):
Chromosome 17 (position 11573000)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11555522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAATTCCTTGGGGAGGTCCCATGGGGCACATTATGACTGTCATTCCT[T/A]GGAGAGGGCTGAGAGTTTGACTTCTCTGGGCTCTAAAGGAGGGGTCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013170 Nonsense 1750 2129 12 15
Genomic Location (Zv9):
Chromosome 17 (position 11573167)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11555689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAAAYGGCAGCAACAATGTACCTCAGTCACCCAAAACAAGTCAATCC[A/T]AAATTTCAGCAGTTAGCAAACTCCTTATGGCAAGCCCAAAAGCTCGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013170 Nonsense 2104 2129 15 15
Genomic Location (Zv9):
Chromosome 17 (position 11577755)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11560277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAGTGGACTCTCTAGAGTACTTGGAAGCTCTGGAGTTTGTGACAGAA[C/T]GACTGGAGAACMGGGTTAACTTCTGCAAAGCTCATCWGATGATGATCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link