anxa6

Ensembl ID:
ENSDARG00000013335
ZFIN IDs:
ZDB-GENE-030707-3, ZDB-GENE-030707-3, ZDB-GENE-030707-3
Description:
annexin A6 [Source:RefSeq peptide;Acc:NP_001002038]
Human Orthologue:
ANXA6
Human Description:
annexin A6 [Source:HGNC Symbol;Acc:544]
Mouse Orthologue:
Anxa6
Mouse Description:
annexin A6 Gene [Source:MGI Symbol;Acc:MGI:88255]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17582 Essential Splice Site Available for shipment Available now
sa32005 Nonsense Mutation detected in F1 DNA During 2016
sa35765 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Essential Splice Site 142 393 6 16
ENSDART00000105346 Essential Splice Site 142 568 6 21
ENSDART00000126260   None 202 None 8
Genomic Location (Zv9):
Chromosome 14 (position 51572625)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50325393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAAAAGTGAGCTGTCCGGAGACTTTGAGAGACTCATGCTGGCTGTMGG[T/C]AAGCTTCRGCAKATCGAGATCAGTTMCTGAAACTCAYATYTGCCTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Nonsense 342 393 13 16
ENSDART00000105346 Nonsense 342 568 13 21
ENSDART00000126260 Nonsense 167 202 6 8
Genomic Location (Zv9):
Chromosome 14 (position 51603548)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50356316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGGTCTCATGATGACACCGGCCGACTTTGACGCCAAGATGATGAAG[A/T]AAGCCATGGAGGTATTTACAGGAAAATTGCAGTGATACAAATATGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Essential Splice Site 376 393 14 16
ENSDART00000105346 Essential Splice Site 376 568 14 21
ENSDART00000126260 Essential Splice Site 201 202 7 8
Genomic Location (Zv9):
Chromosome 14 (position 51605245)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50358013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGAAGCAATCAGGAGATTCAGGAGATGTGCTCGGCCTATCAGAACGG[T/G]AAATATATCGCACAGAGTGCAGCAGGGGGCGCTGTTCATCTGGGAAAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link