anxa6

Ensembl ID:
ENSDARG00000013335
ZFIN IDs:
ZDB-GENE-030707-3, ZDB-GENE-030707-3, ZDB-GENE-030707-3
Description:
annexin A6 [Source:RefSeq peptide;Acc:NP_001002038]
Human Orthologue:
ANXA6
Human Description:
annexin A6 [Source:HGNC Symbol;Acc:544]
Mouse Orthologue:
Anxa6
Mouse Description:
annexin A6 Gene [Source:MGI Symbol;Acc:MGI:88255]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4580 Nonsense Mutation detected in F1 DNA During 2014
sa7748 Nonsense Mutation detected in F1 DNA During 2014
sa17582 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Nonsense 81 393 5 16
ENSDART00000105346 Nonsense 81 568 5 21
ENSDART00000126260 None None 202 None 8
Genomic Location:
Chromosome 14 (position 51566576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTAATGTGATTATAGGAGCTGTA[T/A]GAGGCAGGAGAGGCACAGTGGGGCACAGACGAGGCTAAATTCATCATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Nonsense 116 393 6 16
ENSDART00000105346 Nonsense 116 568 6 21
ENSDART00000126260 None None 202 None 8
Genomic Location:
Chromosome 14 (position 51572545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CNNAGCGAGTATATCATTGTTTGTTTTTCCCAGTGTTTGATGAATATCAG[A/T]AAATTGCAGAGAAATCCATTGAGGACAGTATTAAAAGTGAGCTGTCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Essential Splice Site 142 393 6 16
ENSDART00000105346 Essential Splice Site 142 568 6 21
ENSDART00000126260 None None 202 None 8
Genomic Location:
Chromosome 14 (position 51572625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAAAAGTGAGCTGTCCGGAGACTTTGAGAGACTCATGCTGGCTGTMGG[T/C]AAGCTTCRGCAKATCGAGATCAGTTMCTGAAACTCAYATYTGCCTTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2tzxdjfw