ndufa10

Ensembl ID:
ENSDARG00000013333
ZFIN ID:
ZDB-GENE-030131-670
Description:
NADH dehydrogenase [Source:RefSeq peptide;Acc:NP_955872]
Human Orthologue:
NDUFA10
Human Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa [Source:HGNC Symbol;Acc:7684]
Mouse Orthologue:
Ndufa10
Mouse Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10 Gene [Source:MGI Symbol;Acc:MGI:1914523]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5540 Nonsense F2 line generated During 2017
sa38740 Nonsense Mutation detected in F1 DNA During 2017
sa21484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5540
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010311 Nonsense 187 355 5 10
ENSDART00000141461 Nonsense 187 340 5 10
Genomic Location (Zv9):
Chromosome 9 (position 24778342)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23934128
KASP Assay ID:
554-3521.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGTTAGAACGTATGYGTTGCTTGTTATTTTGCAGGCGTGAATCACTA[T/A]AATGAGATTAAGGGTATCAGTATTTGTGAGTTTCTTCCCCCTCATCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010311 Nonsense 221 355 5 10
ENSDART00000141461 Nonsense 221 340 5 10
Genomic Location (Zv9):
Chromosome 9 (position 24778241)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23934027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTACGTGGACTCACCTGCTGAAGAGGTCCAGAAGAAGCTCAAAGCAT[C/A]AGGAAAGGTATGTGTGAGGACAGAAACAAACTAAGTTTTGGCCAGAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010311 Essential Splice Site 268 355 7 10
ENSDART00000141461 Essential Splice Site 268 340 7 10
Genomic Location (Zv9):
Chromosome 9 (position 24776085)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23931871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGAGGTTCTTACATATGGTGCAGTTGAAGCCCAGGACGTTGAGAAG[G/A]TAATGATCCAGTCTGTGTATTTAGCACCTGAGGCAGGCAAATGTGACTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link