pygmb

Ensembl ID:
ENSDARG00000013317
ZFIN ID:
ZDB-GENE-040426-1206
Description:
phosphorylase, glycogen (muscle) b [Source:RefSeq peptide;Acc:NP_956766]
Human Orthologue:
PYGM
Human Description:
phosphorylase, glycogen, muscle [Source:HGNC Symbol;Acc:9726]
Mouse Orthologue:
Pygm
Mouse Description:
muscle glycogen phosphorylase Gene [Source:MGI Symbol;Acc:MGI:97830]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34052 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101459   None 316 None 10
ENSDART00000127467 Essential Splice Site 333 842 8 21
Genomic Location (Zv9):
Chromosome 7 (position 24001131)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22562883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTTCAACTGAAATAGTGCGCATGGATCTGTCCACACTGCCAGATAAG[G/A]TAGGTCAGACCCAGAGCTGTTTTATGTTAAAGGGATAGTTTACCCAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association study for serum urate concentrations and gout among African Americans identifies genomic risk loci and a novel URAT1 loss-of-function allele. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link