cadps2

Ensembl ID:
ENSDARG00000013312
ZFIN ID:
ZDB-GENE-030903-1
Description:
Zgc:110135 [Source:UniProtKB/TrEMBL;Acc:Q568R8]
Human Orthologue:
CADPS2
Human Description:
Ca++-dependent secretion activator 2 [Source:HGNC Symbol;Acc:16018]
Mouse Orthologue:
Cadps2
Mouse Description:
Ca2+-dependent activator protein for secretion 2 Gene [Source:MGI Symbol;Acc:MGI:2443963]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12715 Nonsense Available for shipment Available now
sa6001 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa25229 Nonsense Mutation detected in F1 DNA During 2014
sa24694 Nonsense Available for shipment Available now
sa24695 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24696 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023890 Nonsense 261 396 4 6
ENSDART00000103500 None None 255 None 11
ENSDART00000112076 Nonsense 131 1155 3 37
Genomic Location:
Chromosome 25 (position 28986069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTTGTGTTTCCYGTGCAGCTKGACAATGTGGACGAGCAGGCAGCG[C/T]AAATYCGCAGAGAGCTGGACGGGCGACTGCAGCTGGCTGAGAAAATAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023890 Splice Site, Nonsense 278 396 4 6
ENSDART00000103500 None None 255 None 11
ENSDART00000112076 Splice Site, Nonsense 148 1155 3 37
Genomic Location:
Chromosome 25 (position 28986120)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCCGCAGAGAGCTGGACGGGCGACTGCAGCTGGCTGAGAAAATAGCC[A/T]GAGTAAGAAATGTTCACCTGTTTCTGTCTTTACTATGAAAATGTAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023890 None None 396 None 6
ENSDART00000103500 None None 255 None 11
ENSDART00000112076 Nonsense 597 1155 22 37
Genomic Location:
Chromosome 25 (position 29057071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCCTCCTTGATTTGACAGACCTGACGGCATGGGCACAGTTACAGAA[C/T]GAGAGAAGGAGGAGTTTGAGGAGATCAGGAGCAGATTGTTGACTTTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023890 None None 396 None 6
ENSDART00000103500 Nonsense 76 255 3 11
ENSDART00000112076 None None 1155 None 37
Genomic Location:
Chromosome 25 (position 29118581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCCCCACATGTCCTGCACGTTATTGCATGAACCCAAGGTTGACCAA[C/T]AGTGGGTAAGTGTCCATTCTACCAAACTTACTTGCATTCAAATAGGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023890 None None 396 None 6
ENSDART00000103500 Essential Splice Site 77 255 3 11
ENSDART00000112076 None None 1155 None 37
Genomic Location:
Chromosome 25 (position 29118588)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACATGTCCTGCACGTTATTGCATGAACCCAAGGTTGACCAACAGTGGG[T/C]AAGTGTCCATTCTACCAAACTTACTTGCATTCAAATAGGACAAAATCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023890 None None 396 None 6
ENSDART00000103500 Nonsense 117 255 5 11
ENSDART00000112076 Nonsense 1002 1155 33 37
Genomic Location:
Chromosome 25 (position 29120587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACAGTTTGCAGCTGTTTTAGATGGGGTGTTGTCGAAACTGTCACGATA[C/A]GACGAGGGAACATTCTTCTCCTCCATCCTGTCTTTCACGGTGAGGCCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eboc9tmy