si:dkey-108d10.2

Ensembl ID:
ENSDARG00000013310
ZFIN ID:
ZDB-GENE-091204-246
Human Orthologue:
MAP3K15
Human Description:
mitogen-activated protein kinase kinase kinase 15 [Source:HGNC Symbol;Acc:31689]
Mouse Orthologue:
Map3k15
Mouse Description:
mitogen-activated protein kinase kinase kinase 15 Gene [Source:MGI Symbol;Acc:MGI:2448588]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13317 Essential Splice Site Available for shipment Available now
sa37904 Nonsense Available for shipment Available now
sa24513 Essential Splice Site Available for shipment Available now
sa44153 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44154 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006615 Essential Splice Site 157 1331 3 29
ENSDART00000143099 Essential Splice Site 157 1321 3 29
Genomic Location (Zv9):
Chromosome 24 (position 26715453)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25773810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTTCTCTTTTCTCTTGCATAGGACATGGTGGCACAGAAAAACACA[G/T]TAAGTGWCAAAAGACTCCTTGCAGGACTGGTAATCCRATGAGGTTTGGYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006615 Nonsense 199 1331 4 29
ENSDART00000143099 Nonsense 199 1321 4 29
Genomic Location (Zv9):
Chromosome 24 (position 26722075)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25780432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCCAGCGCAGAGCATCAGAGTACATGCAGCCCAACTGGGACAACCTTT[T/A]AGGACCTCTGTGTGTCCCTTTGGTGGACCGCTTCGTCAGCCTTCTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006615 Essential Splice Site 314 1331 7 29
ENSDART00000143099 Essential Splice Site 314 1321 7 29
Genomic Location (Zv9):
Chromosome 24 (position 26725229)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25783586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTCAGGAAAAAATGCATTTATATTTGTGTGTGTGTGTGTGCAAACTC[A/T]GACGAAACAGCCCTGGTGATCGAGAGCAGGCGCTGCGTGTGATGTTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006615 Essential Splice Site 597 1331 13 29
ENSDART00000143099 Essential Splice Site 586 1321 13 29
Genomic Location (Zv9):
Chromosome 24 (position 26735735)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25794092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCAGATGACTTCCAGATCTACTTCTCCACAGAGGACCAGTGCGGCAG[G/A]TTGGCATTCAATGACACCCATCACTTTGTATTATTTCTGTATGTGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006615 Essential Splice Site 671 1331 15 29
ENSDART00000143099 Essential Splice Site 660 1321 15 29
Genomic Location (Zv9):
Chromosome 24 (position 26737564)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25795921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAATCAGGTGCGCATTGCCATCAAGGAGATCCCTGAGAGAGACAGCAG[G/A]TGAGAGACTTGAGTCAAACCCATCTAAAAAAATAACAACAACAGCTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link