rpl19

Ensembl ID:
ENSDARG00000013307
ZFIN ID:
ZDB-GENE-040426-2290
Description:
60S ribosomal protein L19 [Source:UniProtKB/Swiss-Prot;Acc:Q6P5L3]
Human Orthologue:
RPL19
Human Description:
ribosomal protein L19 [Source:HGNC Symbol;Acc:10312]
Mouse Orthologue:
Rpl19
Mouse Description:
ribosomal protein L19 Gene [Source:MGI Symbol;Acc:MGI:98020]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26022 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018975 Essential Splice Site 36 194 None 6
ENSDART00000121728 Essential Splice Site 38 196 None 6

The following transcripts of ENSDARG00000013307 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 15851136)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16081355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGGCTGGACCCAAACGAAACCAACGAAATTGCCAATGCAAACTCCCG[T/G]ATGCAATTTCAATTCAGTTCATTATTTCTACAGCGCTTTTACAATGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link