tmem179

Ensembl ID:
ENSDARG00000013292
ZFIN ID:
ZDB-GENE-040808-25
Description:
Transmembrane protein 179 [Source:UniProtKB/Swiss-Prot;Acc:Q6AZD1]
Human Orthologue:
TMEM179
Human Description:
transmembrane protein 179 [Source:HGNC Symbol;Acc:20137]
Mouse Orthologue:
Tmem179
Mouse Description:
transmembrane protein 179 Gene [Source:MGI Symbol;Acc:MGI:2144891]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4905 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa4905
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005473 Nonsense 205 232 4 4
ENSDART00000130095 Nonsense 216 243 4 4
Genomic Location:
Chromosome 20 (position 27425652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGGCCTTCCTGAAGGTTTACCATAACCACCGACAGCAGGAGCTGCTA[G/T]AGAGTCTAGTTCAAGAGAAGGAGCTTCTGCTTGGTCATCCTTTACAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sec9v6f2