LOC561497

Ensembl ID:
ENSDARG00000013252
Human Orthologue:
TMC5
Human Description:
transmembrane channel-like 5 [Source:HGNC Symbol;Acc:22999]
Mouse Orthologue:
Tmc5
Mouse Description:
transmembrane channel-like gene family 5 Gene [Source:MGI Symbol;Acc:MGI:1921674]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8120 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6891 Essential Splice Site Mutation detected in F1 DNA During 2014
sa506 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114552 Essential Splice Site 31 685 2 18
Genomic Location:
Chromosome 3 (position 26280770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAAANNNNAAAANCAAAAAAAAAAAACATATACAATCCTTACTTKTGTCCCC[A/T]GATACGTCTGAACTGGTATCAGATCTGTCAGACCTGTCAGCYGGAGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114552 Essential Splice Site 89 685 4 18
Genomic Location:
Chromosome 3 (position 26280415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATTCATCATAKTAYTATATSATTATTCTGAAAACAAAAYACACCTTC[A/G]GTCTTTCCGMAGGTTTCGTGCCAGCTKGACATCCGCCAGGCAGCGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114552 Nonsense 405 685 10 18
Genomic Location:
Chromosome 3 (position 26274788)
KASP Assay ID:
554-0225.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATGCCTCTTTGTTTGTTTGTAATCTTTTTTCTTTTTATTATAGTGTT[G/A]GGAGTCCTTTGTAGGACAGAGTGTATATCGACTTCTGATCATTGACTTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fu7chyia