LOC561497

Ensembl ID:
ENSDARG00000013252
Human Orthologue:
TMC5
Human Description:
transmembrane channel-like 5 [Source:HGNC Symbol;Acc:22999]
Mouse Orthologue:
Tmc5
Mouse Description:
transmembrane channel-like gene family 5 Gene [Source:MGI Symbol;Acc:MGI:1921674]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6891 Essential Splice Site Mutation detected in F1 DNA During 2016
sa506 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114552 Essential Splice Site 89 685 4 18
Genomic Location (Zv9):
Chromosome 3 (position 26280415)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26606557
KASP Assay ID:
554-5358.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATTCATCATAKTAYTATATSATTATTCTGAAAACAAAAYACACCTTC[A/G]GTCTTTCCGMAGGTTTCGTGCCAGCTKGACATCCGCCAGGCAGCGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114552 Nonsense 405 685 10 18
Genomic Location (Zv9):
Chromosome 3 (position 26274788)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26612184
KASP Assay ID:
554-0225.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATGCCTCTTTGTTTGTTTGTAATCTTTTTTCTTTTTATTATAGTGTT[G/A]GGAGTCCTTTGTAGGACAGAGTGTATATCGACTTCTGATCATTGACTTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link