tars

Ensembl ID:
ENSDARG00000013250
ZFIN ID:
ZDB-GENE-041010-218
Description:
threonyl-tRNA synthetase, cytoplasmic isoform 1 [Source:RefSeq peptide;Acc:NP_001116258]
Human Orthologue:
TARS
Human Description:
threonyl-tRNA synthetase [Source:HGNC Symbol;Acc:11572]
Mouse Orthologue:
Tars
Mouse Description:
threonyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:106314]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9871 Essential Splice Site Available for shipment Available now
sa31471 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17576 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034523 Essential Splice Site 187 718 5 19
ENSDART00000051141 Essential Splice Site 187 624 5 18
Genomic Location:
Chromosome 5 (position 45970954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCACCCATCGAAAAKGRCTTTTACTATGATATGTATCTTGATAATGA[G/A]TAAGTCAAACACATTTTCAGTTCATTTTTTAATGTTTATTTATTTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034523 Essential Splice Site 572 718 15 19
ENSDART00000051141 Essential Splice Site 478 624 14 18
Genomic Location:
Chromosome 5 (position 45984756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGCTGGACTTCCAGCTGCCCATTCGCTTCAATCTCACATTTGTAAG[G/T]TGTGTTTACTCAGTGAAACATTACAGCCTGTGTACAATAATGAGTGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034523 Nonsense 610 718 17 19
ENSDART00000051141 Nonsense 516 624 16 18
Genomic Location:
Chromosome 5 (position 45985146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTTCGCATAAAAYATAYGCCTGATTTTATTTCCCACAGGCCACTTTG[G/A]TTGTCCCCGCGTCAGGTGATGGTGGTTCCTATTGGACCCACCTGTGAKGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link