tars

Ensembl ID:
ENSDARG00000013250
ZFIN ID:
ZDB-GENE-041010-218
Description:
threonyl-tRNA synthetase, cytoplasmic isoform 1 [Source:RefSeq peptide;Acc:NP_001116258]
Human Orthologue:
TARS
Human Description:
threonyl-tRNA synthetase [Source:HGNC Symbol;Acc:11572]
Mouse Orthologue:
Tars
Mouse Description:
threonyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:106314]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9871 Essential Splice Site Available for shipment Available now
sa17576 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034523 Essential Splice Site 187 718 5 19
ENSDART00000051141 Essential Splice Site 187 624 5 18
Genomic Location:
Chromosome 5 (position 45970954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCACCCATCGAAAAKGRCTTTTACTATGATATGTATCTTGATAATGA[G/A]TAAGTCAAACACATTTTCAGTTCATTTTTTAATGTTTATTTATTTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034523 Nonsense 610 718 17 19
ENSDART00000051141 Nonsense 516 624 16 18
Genomic Location:
Chromosome 5 (position 45985146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTTCGCATAAAAYATAYGCCTGATTTTATTTCCCACAGGCCACTTTG[G/A]TTGTCCCCGCGTCAGGTGATGGTGGTTCCTATTGGACCCACCTGTGAKGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qu2s76gl