si:ch211-67n3.1

Ensembl ID:
ENSDARG00000013245
ZFIN ID:
ZDB-GENE-030131-1961
Description:
hypothetical protein LOC555492 [Source:RefSeq peptide;Acc:NP_001037798]
Human Orthologue:
C10orf26
Human Description:
chromosome 10 open reading frame 26 [Source:HGNC Symbol;Acc:23510]
Mouse Orthologue:
D19Wsu162e
Mouse Description:
DNA segment, Chr 19, Wayne State University 162, expressed Gene [Source:MGI Symbol;Acc:MGI:107577]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35504 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24935 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007211 Essential Splice Site 139 375 3 4
Genomic Location (Zv9):
Chromosome 13 (position 28816242)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28462190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCCTACAGAGAAGCCCATAACTACTCCTCTCTGCCCTTCTACTTCAG[T/G]CAGTACCTGCTTCCCTCATTCTTAATACAATCTCAAAACAATAAAAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007211 Nonsense 149 375 4 4
Genomic Location (Zv9):
Chromosome 13 (position 28819686)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28465634
KASP Assay ID:
554-7413.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTCTTCTCTTCTTCAGGGTTTCTACCTGGCTACCTCTTACCAGCCTA[T/A]GAGGAAGTAGAGAACAGACCTCCAACACCCCCTCCTCCATACAGTGCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link