dhcr24

Ensembl ID:
ENSDARG00000013236
ZFIN ID:
ZDB-GENE-041212-73
Description:
24-dehydrocholesterol reductase [Source:RefSeq peptide;Acc:NP_001008645]
Human Orthologue:
DHCR24
Human Description:
24-dehydrocholesterol reductase [Source:HGNC Symbol;Acc:2859]
Mouse Orthologue:
Dhcr24
Mouse Description:
24-dehydrocholesterol reductase Gene [Source:MGI Symbol;Acc:MGI:1922004]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15847 Nonsense Available for shipment Available now
sa3089 Nonsense F2 line generated During 2017
sa5668 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa15847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125019 Nonsense 50 516 1 9

The following transcripts of ENSDARG00000013236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 7351270)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7186663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGTGTGCCTGTTTCTCCTGCCCTTGTCCGTCGTGTTTGATGTRTACTA[T/A]CAYCTGCGCGCCTGGATCATCTTCAAGATGTGCTCCGCGCCCAAACAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3089
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125019 Nonsense 482 516 9 9
ENSDART00000125019 Nonsense 482 516 9 9

The following transcripts of ENSDARG00000013236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 7324091)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7159484
KASP Assay ID:
554-3402.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTCCAGATGTTGTATGCTGATGTATACATGGAACRCAAKGAATTCTG[G/A]GAGATGTTTGACGGCACTTTGTATCACAAACTCAGAGAGGAGCTCGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5668
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125019 Nonsense 482 516 9 9
ENSDART00000125019 Nonsense 482 516 9 9

The following transcripts of ENSDARG00000013236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 7324091)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7159484
KASP Assay ID:
554-3402.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTCCAGATGTTGTATGCTGATGTATACATGGAACRCAAKGAATTCTG[G/A]GAGATGTTTGACGGCACTTTGTATCACAAACTCAGAGAGGAGCTCGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link