pde4c

Ensembl ID:
ENSDARG00000013221
ZFIN ID:
ZDB-GENE-070912-373
Human Orthologue:
PDE4C
Human Description:
phosphodiesterase 4C, cAMP-specific [Source:HGNC Symbol;Acc:8782]
Mouse Orthologue:
Pde4c
Mouse Description:
phosphodiesterase 4C, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99556]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39831 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002096 Nonsense 599 618 14 14
ENSDART00000131795   None 145 None 4
ENSDART00000141030 Nonsense 480 516 10 10
ENSDART00000145692   None 58 None 3

The following transcripts of ENSDARG00000013221 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24632303)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25207080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGGTGGCATCGCTTCAGCGGGGGATAAATTCCAGTTTGAACTGACCT[T/A]GGAAGAGGAAGGTGAGTCTGACGTGGAGAGTCCCGTGGATGAAGACTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link