LOC798599

Ensembl ID:
ENSDARG00000013210
Human Orthologue:
HTR2C
Human Description:
5-hydroxytryptamine (serotonin) receptor 2C [Source:HGNC Symbol;Acc:5295]
Mouse Orthologue:
Htr2c
Mouse Description:
5-hydroxytryptamine (serotonin) receptor 2C Gene [Source:MGI Symbol;Acc:MGI:96281]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5962 Nonsense Mutation detected in F1 DNA During 2014
sa24033 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12052 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036537 Nonsense 101 355 2 3
Genomic Location:
Chromosome 21 (position 42020757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGTTGTCTGCTTCCAGATCACACCTGGCCTCTCCCRCAGCYGCTGTG[T/A]CCGCTGTGGATCTTTCTGGACGTGCTTTTCTCCACAGCYTCCATCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036537 Essential Splice Site 158 355 2 3
Genomic Location:
Chromosome 21 (position 42020586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCGCAAGGCCATGATCAAAATAATCACCGTGTGGACCATTTCTATAGG[T/A]GAGAGAAGCATTCAGTGGTGAGAGTTACAATAATGGGTAACACTTTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036537 Nonsense 348 355 3 3
Genomic Location:
Chromosome 21 (position 42015256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCCTGATTTACACCCTTTTCAACAAGACKTACCGCCAAGCCTTCGCT[C/T]GATACCTTCGCTGTAAATTTCACTAGGAAACACCACAGGAGAAGTCTGWG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pj2pzs6l