pcbp2

Ensembl ID:
ENSDARG00000013184
ZFIN ID:
ZDB-GENE-030131-563
Description:
poly(rC)-binding protein 2 [Source:RefSeq peptide;Acc:NP_957486]
Human Orthologues:
PCBP3, PCBP4
Human Descriptions:
poly(rC) binding protein 3 [Source:HGNC Symbol;Acc:8651]
poly(rC) binding protein 4 [Source:HGNC Symbol;Acc:8652]
Mouse Orthologues:
Pcbp3, Pcbp4
Mouse Descriptions:
poly(rC) binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1890470]
poly(rC) binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1890471]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41325 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38716 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa15679 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025885 Essential Splice Site 31 318 2 12
ENSDART00000131317 Essential Splice Site 31 179 2 8

The following transcripts of ENSDARG00000013184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 221687)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 262823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCCGGCTGCTCATGCATGGCAAAGAAGTGGGCAGCATTATTGGGAAG[G/A]TGTGTTGGAGAAGCTTCAGTTTGTGTGCTCAGTCACATCATCACCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025885 Splice Site, Nonsense 193 318 7 12
ENSDART00000131317 Splice Site, Nonsense 154 179 6 8

The following transcripts of ENSDARG00000013184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 228218)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 256292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTTACCGACCCAAACCCTCAGGATCGCCTGTCATTTTTGCAGGAGGA[C/T]AGGTGGGTGTGTGTTTGTTCGTGTGGGTGTGTGTGCATGCACATCCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025885 Essential Splice Site 307 318 11 12
ENSDART00000131317   None 179 None 8

The following transcripts of ENSDARG00000013184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 229753)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 254757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCTCACCCGCCAGCATCAGCCTGGCCGAATACCTGATCAATGCACGG[T/G]AAACRCACGCCAGCCAGCACCACAMTATCMTAACCGGGTCTTCATAACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Insulin resistance/response: Genome-wide detection of allele specific copy number variation associated with insulin resistance in African Americans from the HyperGEN study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link