si:dkey-147f23.1

Ensembl ID:
ENSDARG00000013177
ZFIN ID:
ZDB-GENE-081104-49
Description:
LOC100004228 protein [Source:UniProtKB/TrEMBL;Acc:Q1ECW0]
Human Orthologues:
SLC27A2, SLC27A5
Human Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 [Source:HGNC Symbol;Acc:10996]
solute carrier family 27 (fatty acid transporter), member 5 [Source:HGNC Symbol;Acc:10999]
Mouse Orthologues:
Slc27a2, Slc27a5
Mouse Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:1347099]
solute carrier family 27 (fatty acid transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1347100]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39489 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38111 Nonsense Available for shipment Available now
sa6003 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086334 Essential Splice Site 281 618 3 10
ENSDART00000145015 Essential Splice Site 279 415 3 6
Genomic Location (Zv9):
Chromosome 25 (position 33284478)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31894880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCACAGCTCTGGCTTTGGCCTCGGGTTCGGAGGTTCTGTTGAACGAGG[T/A]ATTTCATTGACTTCTTTTACTGTTAGTTTTGTTTAGTTTTCTGTACATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086334 Nonsense 412 618 6 10
ENSDART00000145015 Nonsense 410 415 6 6
Genomic Location (Zv9):
Chromosome 25 (position 33279928)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31890330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTTGATCATGAGAAAGAGGAGCCCGTCAGAAACGCTGATGGATTTTG[T/A]ATTGAAGTTGCAAAGGGCAAGTAATATGGAGCCAATAATGTGACAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086334 Essential Splice Site 484 618 7 10
ENSDART00000145015   None 415 None 6
Genomic Location (Zv9):
Chromosome 25 (position 33276258)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31886660
KASP Assay ID:
554-3880.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGAGAAAACTTCATCTACTTCCAGGATCGGGTGGGCGACACTTTTAGG[T/A]GAATCAATCACATGAATACAGTGGGTTTACATNNNNNGGCTTCTCCATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link