cpne3

Ensembl ID:
ENSDARG00000013175
ZFIN ID:
ZDB-GENE-040426-763
Description:
copine-3 [Source:RefSeq peptide;Acc:NP_956461]
Human Orthologue:
CPNE3
Human Description:
copine III [Source:HGNC Symbol;Acc:2316]
Mouse Orthologue:
Cpne3
Mouse Description:
copine III Gene [Source:MGI Symbol;Acc:MGI:1917818]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37917 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9988 Nonsense Available for shipment Available now
sa44168 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011886 Essential Splice Site 337 532 11 16
ENSDART00000126256 Essential Splice Site 337 532 10 16
Genomic Location (Zv9):
Chromosome 24 (position 31150767)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31456837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTCAGCCATCTGGTCAGTCGGCCTTGTGGTTCAGGACTACGACAGG[T/C]AGATGAGCACAATGAGTACATTTTTTCACTTTTATTAATTTCTGAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011886 Nonsense 411 532 14 16
ENSDART00000126256 Nonsense 411 532 13 16
Genomic Location (Zv9):
Chromosome 24 (position 31147131)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31460473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTTTGCTCCTATCATCAACCATATGGCTCGTTTTGCACAGCAGGCGT[T/A]WCAGCAGAAAACGGCATYRGTRAGATTGAGGYCAAACGCACRATGATYCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011886   None 532 16 16
ENSDART00000126256 Essential Splice Site None 532 None 16
Genomic Location (Zv9):
Chromosome 24 (position 31142721)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31464883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATATATAAACCTGTCACCTCCGAACGAGCCAAAACATTCATAGACATG[T/C]AGGGCTCTCTTCTTTATCTGCACCTGACCAATGCCATGCTCATGTCTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link