cpne3

Ensembl ID:
ENSDARG00000013175
ZFIN ID:
ZDB-GENE-040426-763
Description:
copine-3 [Source:RefSeq peptide;Acc:NP_956461]
Human Orthologue:
CPNE3
Human Description:
copine III [Source:HGNC Symbol;Acc:2316]
Mouse Orthologue:
Cpne3
Mouse Description:
copine III Gene [Source:MGI Symbol;Acc:MGI:1917818]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9988 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011886 Nonsense 411 532 14 16
ENSDART00000126256 Nonsense 411 532 13 16
Genomic Location:
Chromosome 24 (position 31147131)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTTTGCTCCTATCATCAACCATATGGCTCGTTTTGCACAGCAGGCGT[T/A]WCAGCAGAAAACGGCATYRGTRAGATTGAGGYCAAACGCACRATGATYCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qlluwg9d