jag1b

Ensembl ID:
ENSDARG00000013168
ZFIN ID:
ZDB-GENE-011128-4
Description:
Protein jagged-1b [Source:UniProtKB/Swiss-Prot;Acc:Q90Y54]
Human Orthologue:
JAG1
Human Description:
jagged 1 [Source:HGNC Symbol;Acc:6188]
Mouse Orthologue:
Jag1
Mouse Description:
jagged 1 Gene [Source:MGI Symbol;Acc:MGI:1095416]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17080 Essential Splice Site Available for shipment Available now
sa42247 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18567 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019323 Essential Splice Site 24 1213 1 26
Genomic Location (Zv9):
Chromosome 13 (position 35561110)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35213686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTCTGCTTTTTACCTTCATGCCTTTTTGTTATGCTTGCGGACGACGG[T/C]GAGTCTTGATTTAAGTCATTAMATAGTTTGGGGTAAWTTGTTTAARAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019323 Essential Splice Site 520 1213 12 26
Genomic Location (Zv9):
Chromosome 13 (position 35588618)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35241194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGATTTCAGTGCCTGTGTCCTGCTGGCTTTTCGGGTCAACTGTGTCAG[G/A]TAATTTATACTTGTTTATTTTGCAGTATTTGAATATTTAAACGTTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019323 Essential Splice Site 891 1213 22 26
Genomic Location (Zv9):
Chromosome 13 (position 35603208)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35255784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACTGCAACATTTGTCAGTGCCAAAATGGAAGGATTCATTGCACAATG[G/A]TACATASCTGACACTTCATCATATTCCTGAGGCATTTAGTARCATTTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)
  • Bone mineral density: Association of JAG1 with bone mineral density and osteoporotic fractures: a genome-wide association study and follow-up replication studies. (View Study)
  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)
  • Systolic blood pressure: Genetic variants in novel pathways influence blood pressure and cardiovascular disease risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link