dennd3b

Ensembl ID:
ENSDARG00000013153
ZFIN ID:
ZDB-GENE-091230-7
Human Orthologue:
DENND3
Human Description:
DENN/MADD domain containing 3 [Source:HGNC Symbol;Acc:29134]
Mouse Orthologue:
Dennd3
Mouse Description:
DENN/MADD domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2146009]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11410 Nonsense Available for shipment Available now
sa42755 Nonsense Mutation detected in F1 DNA During 2017
sa42754 Nonsense Mutation detected in F1 DNA During 2017
sa18385 Nonsense Available for shipment Available now
sa42753 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39108 Nonsense Mutation detected in F1 DNA During 2017
sa2847 Nonsense Available for shipment Available now
sa42752 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36176 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39107 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36175 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Nonsense 30 1262 2 25
ENSDART00000124555   None 256 None 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996 Nonsense 30 452 2 10
Genomic Location (Zv9):
Chromosome 16 (position 33204667)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30943182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGCATGCACCCTKTGATTTSTATGTTTTCTTTATTTTSTTCAGTCTT[T/A]GTCACAACTGAATGGAAGTCCTCTTCCTCTGYTCGATCCTGAGGTTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Nonsense 57 1262 2 25
ENSDART00000124555   None 256 None 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996 Nonsense 57 452 2 10
Genomic Location (Zv9):
Chromosome 16 (position 33204587)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30943102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCGATCCTGAGGTTCTGCAGGTCCACAGGCCTCTGTTTTGCCTTAAA[C/T]AGAATGTCACGGAACCGGCTGTGGAAACCTTAAGTCCGACTCAGCAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Nonsense 129 1262 3 25
ENSDART00000124555   None 256 None 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996 Nonsense 129 452 3 10
Genomic Location (Zv9):
Chromosome 16 (position 33203740)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30942255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGTCTAAATCAGGAGGACTTCAGGTAACTAAGAAGCAAAAGGATGAA[C/T]AGTTCCATTACTTGGTCTTCACCGATGTGCTTGGAAACCAGTCTCATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Nonsense 231 1262 5 25
ENSDART00000124555   None 256 None 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996 Nonsense 231 452 5 10
Genomic Location (Zv9):
Chromosome 16 (position 33201137)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30939652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAGGAGTTTTCTGCTAAACTATCTGTGGTCCCAGTTCCCCCTCCTGGT[C/T]AGCTGCATGTGGTGGGTTCAGAAGATCAGGAGGCWGATTAAAACTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Essential Splice Site 472 1262 11 25
ENSDART00000124555   None 256 None 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996 Essential Splice Site 419 452 10 10
Genomic Location (Zv9):
Chromosome 16 (position 33197402)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30935917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAGAAATAGAACCAAACTGTGTAACTAATAGCATTTTCTTTACAACA[G/T]GTCTTGGAAACACCTATTTTCCACTCCTTTTTAAAAGAACGTTTGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Nonsense 769 1262 15 25
ENSDART00000124555   None 256 None 5
ENSDART00000131356 Nonsense 30 306 1 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996   None 452 None 10
Genomic Location (Zv9):
Chromosome 16 (position 33189308)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30927823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTACAAATTCTGGAAGGAGACTGAGGCAGAAGCCCAGGACGTTCTTT[T/A]GCCTGCTGAGGTCCTGGAGCGCCTGGACAGTAATGAGTGTGTCTACAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Nonsense 785 1262 15 25
ENSDART00000124555   None 256 None 5
ENSDART00000131356 Nonsense 46 306 1 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996   None 452 None 10
Genomic Location (Zv9):
Chromosome 16 (position 33189261)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30927776
KASP Assay ID:
554-2731.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGCCTGCTGAGGTCCTGGAGCGCCTGGACAGTAATGAGTGTGTCTAC[A/T]AGCTGTCCAGGTCTGTGAAGACCAGTTATGGTGTTGGGAAAATAGCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Essential Splice Site 961 1262 18 25
ENSDART00000124555   None 256 None 5
ENSDART00000131356 Essential Splice Site 222 306 4 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996   None 452 None 10
Genomic Location (Zv9):
Chromosome 16 (position 33187932)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30926447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAACATGATGAATCCCCAGTCTGTTGATGTCCTGTTCTACTCTCCAG[G/A]TCTGCACATTTAGTGCATTAGCTATTTAGGATGTTAAAGCGTCCCTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Essential Splice Site 1107 1262 None 25
ENSDART00000124555 Essential Splice Site 101 256 None 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996   None 452 None 10
ENSDART00000035583 Essential Splice Site 1107 1262 None 25
ENSDART00000124555 Essential Splice Site 101 256 None 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996   None 452 None 10
Genomic Location (Zv9):
Chromosome 16 (position 33182605)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30921120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGACAGACTGCAGTCCATTCAGATTCACAATGGAGCCTTATGGTGTGG[T/A]GAGTTTATCATCAACCTAACAAATCAAGCACTGTTGTTAACTACAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Essential Splice Site 1107 1262 None 25
ENSDART00000124555 Essential Splice Site 101 256 None 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996   None 452 None 10
ENSDART00000035583 Essential Splice Site 1107 1262 None 25
ENSDART00000124555 Essential Splice Site 101 256 None 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996   None 452 None 10
Genomic Location (Zv9):
Chromosome 16 (position 33182605)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30921120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGACAGACTGCAGTCCATTCAGATTCACAATGGAGCCTTATGGTGTGG[T/A]GAGTTTATCATCAACCTAACAAATCAAGCACTGTTGTTAACTACAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035583 Essential Splice Site 1107 1262 23 25
ENSDART00000124555 Essential Splice Site 101 256 3 5
ENSDART00000131356   None 306 None 6
ENSDART00000141403   None 113 None 2
ENSDART00000143996   None 452 None 10
Genomic Location (Zv9):
Chromosome 16 (position 33182435)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30920950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATTCTGAATTTACAATAACAATCTGAATTTATACTAATTTTTTCATT[G/T]TATGTGAAGGTGCCAGGGACTGTATAATGATGCTGAAGCCTAATGGAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link