dhx16

Ensembl ID:
ENSDARG00000013150
ZFIN ID:
ZDB-GENE-030131-8589
Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 16 [Source:RefSeq peptide;Acc:NP_956318]
Human Orthologue:
DHX16
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 16 [Source:HGNC Symbol;Acc:2739]
Mouse Orthologue:
Dhx16
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 16 Gene [Source:MGI Symbol;Acc:MGI:1916442]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35958 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39062 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42595 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006288 Essential Splice Site None 1054 1 21
Genomic Location (Zv9):
Chromosome 15 (position 34229739)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35075515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGCATACATGTTGTTGTAAGAGAAAGCGTGTGGAGAGACAACTAAACG[T/A]AAGTTTAGCGTTTCCAGTGTTAATGTTTAAGTTTGTGAACCAGTATACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006288 Essential Splice Site 66 1054 2 21
Genomic Location (Zv9):
Chromosome 15 (position 34226780)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35072556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACATTGATCAAAGAATCACAGCGTTTGCACATGAGTTGTACGACAAGG[T/A]ATGTTTTTTAAGGTCAATACACAGAATGTTAATGTAATACTTGAATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006288 Nonsense 364 1054 7 21
Genomic Location (Zv9):
Chromosome 15 (position 34220975)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35066751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCAGACAAGAGCGCGAACGGCGGATCAAGGAGGAGCAGGAGAGATAC[C/T]AGCTCATTTTAGAGGAAGAGGAGATGATCACCTTCGTCAGCACCGCAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link