atp1b1a

Ensembl ID:
ENSDARG00000013144
ZFIN ID:
ZDB-GENE-001127-3
Description:
ATPase, Na+/K+ transporting, beta 1a polypeptide [Source:RefSeq peptide;Acc:NP_571743]
Human Orthologue:
ATP1B1
Human Description:
ATPase, Na+/K+ transporting, beta 1 polypeptide [Source:HGNC Symbol;Acc:804]
Mouse Orthologue:
Atp1b1
Mouse Description:
ATPase, Na+/K+ transporting, beta 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88108]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20716 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006386 Nonsense 280 306 6 6
ENSDART00000127637 Nonsense 280 306 6 7

The following transcripts of ENSDARG00000013144 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 28940003)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTACAACATCACTACAGACGTGGACGTACGCGTGGAATGCAAAGTATA[C/A]GGAGAAAACATCGATTACAGCGAGAAGGACCGTTCTCAGGGACGTTTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval: Common variants at ten loci modulate the QT interval duration in the QTSCD Study. (View Study)
  • QT interval: Impact of ancestry and common genetic variants on QT interval in African Americans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kfndcf4w