maf1

Ensembl ID:
ENSDARG00000013122
ZFIN ID:
ZDB-GENE-040426-2788
Description:
Repressor of RNA polymerase III transcription MAF1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6PGU2]
Human Orthologue:
MAF1
Human Description:
MAF1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24966]
Mouse Orthologue:
Maf1
Mouse Description:
MAF1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1916127]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12335 Nonsense Available for shipment Available now
sa16843 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006703 Nonsense 34 247 2 7
Genomic Location:
Chromosome 11 (position 25009243)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCTGTNNCACTGTTTTGATGTGTCTGCAGCATTGAGAGCTACTCCTG[T/A]AAGATGGCAGGTGAKGACAAGCAGATGTTCAAGCAGTTTTGTCAGGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006703 Nonsense 56 247 2 7
Genomic Location:
Chromosome 11 (position 25009178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KGACAAGCAGATGTTCAAGCAGTTTTGTCAGGAGGGGCAACCGCATGTGT[T/A]GGAGGCTTTGTCTCCTCCACAGAGCTCTGGAATCAGCCCTAACAAGTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/etn30p27