gclc

Ensembl ID:
ENSDARG00000013095
ZFIN ID:
ZDB-GENE-030131-5056
Description:
glutamate--cysteine ligase catalytic subunit [Source:RefSeq peptide;Acc:NP_954971]
Human Orthologue:
GCLC
Human Description:
glutamate-cysteine ligase, catalytic subunit [Source:HGNC Symbol;Acc:4311]
Mouse Orthologue:
Gclc
Mouse Description:
glutamate-cysteine ligase, catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:104990]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35401 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017148 Nonsense 403 631 11 16
ENSDART00000126697   None 222 4 9
Genomic Location (Zv9):
Chromosome 13 (position 2167339)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2266635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTATGCACATATGAAGTGTTGTTTCTTTGGCACGTTACAGAACATT[C/T]AGTCCACCAACTGGCAGACCATGAGGTTCAAGCCCCCTCCGCCAAACTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link