ndrg3a

Ensembl ID:
ENSDARG00000013087
ZFIN ID:
ZDB-GENE-980526-124
Description:
N-myc downstream regulated family member 3a [Source:RefSeq peptide;Acc:NP_955811]
Human Orthologue:
NDRG3
Human Description:
NDRG family member 3 [Source:HGNC Symbol;Acc:14462]
Mouse Orthologue:
Ndrg3
Mouse Description:
N-myc downstream regulated gene 3 Gene [Source:MGI Symbol;Acc:MGI:1352499]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35087 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016181 Essential Splice Site 147 362 7 16
ENSDART00000127105 Essential Splice Site 120 345 5 15
ENSDART00000127399 Essential Splice Site 120 335 5 14
ENSDART00000128705 Essential Splice Site 147 375 6 16
ENSDART00000132879   None 199 None 9
ENSDART00000147546 Essential Splice Site 134 256 5 10
Genomic Location (Zv9):
Chromosome 11 (position 26055981)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24884806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGGCATTGGAGTGGGCGCAGGAGCGTACATCTTAACCCGCTTCGCTG[T/G]AAGTCCTTTTTTTTAGTTTGATTCAATGAATGGTCCCACTTTATGGTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link