tubgcp2

Ensembl ID:
ENSDARG00000013079
ZFIN ID:
ZDB-GENE-031118-150
Description:
gamma-tubulin complex component 2 [Source:RefSeq peptide;Acc:NP_956416]
Human Orthologue:
TUBGCP2
Human Description:
tubulin, gamma complex associated protein 2 [Source:HGNC Symbol;Acc:18599]
Mouse Orthologue:
Tubgcp2
Mouse Description:
tubulin, gamma complex associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:1921487]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22037 Nonsense Available for shipment Available now
sa35216 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35217 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020192 Nonsense 83 882 3 18
ENSDART00000142128 Nonsense 83 882 2 17
Genomic Location (Zv9):
Chromosome 12 (position 9938566)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9146521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGATGAACTGAAGTCAAAGAATGCTCGCAACCTTGATCCACTGGTGTA[T/A]CTGCTCTCCAAACTCACTGAAGATAAAGAGGTGCAGTACCAGATTTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020192 Essential Splice Site 804 882 17 18
ENSDART00000142128 Essential Splice Site 804 882 16 17
Genomic Location (Zv9):
Chromosome 12 (position 9967972)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9175927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTTTAGGTGAAGTATTCCTTTAATCTGATCTGTTTGTCTTCATCTTA[G/A]TTTCTAGCTGAGCATGTGGATGCTCTTCAGTCTGACTCCGGGTTCGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020192 Nonsense 813 882 17 18
ENSDART00000142128 Nonsense 813 882 16 17
Genomic Location (Zv9):
Chromosome 12 (position 9968000)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9175955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCTGTTTGTCTTCATCTTAGTTTCTAGCTGAGCATGTGGATGCTCTT[C/T]AGTCTGACTCCGGGTTCGAGGGGACCATCAGCAAGTTTGACAGTAACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link