tubgcp2

Ensembl ID:
ENSDARG00000013079
ZFIN ID:
ZDB-GENE-031118-150
Description:
gamma-tubulin complex component 2 [Source:RefSeq peptide;Acc:NP_956416]
Human Orthologue:
TUBGCP2
Human Description:
tubulin, gamma complex associated protein 2 [Source:HGNC Symbol;Acc:18599]
Mouse Orthologue:
Tubgcp2
Mouse Description:
tubulin, gamma complex associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:1921487]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22037 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020192 Nonsense 83 882 3 18
ENSDART00000142128 Nonsense 83 882 2 17
Genomic Location:
Chromosome 12 (position 9938566)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGATGAACTGAAGTCAAAGAATGCTCGCAACCTTGATCCACTGGTGTA[T/A]CTGCTCTCCAAACTCACTGAAGATAAAGAGGTGCAGTACCAGATTTGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lcs2fybx