ywhaba

Ensembl ID:
ENSDARG00000013078
ZFIN ID:
ZDB-GENE-030131-6583
Description:
14-3-3 protein beta/alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q5PRD0]
Human Orthologues:
YWHAB, YWHAZ
Human Descriptions:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide [Source:HGN
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide [Source:HGN
Mouse Orthologues:
Ywhab, Ywhaz
Mouse Descriptions:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene [Sourc
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide Gene [Sourc

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16229 Essential Splice Site Available for shipment Available now
sa8247 Nonsense Mutation detected in F1 DNA During 2014
sa11447 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025940 Essential Splice Site None 244 1 6
ENSDART00000143458 None None 226 None 5
Genomic Location:
Chromosome 6 (position 52163531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTCCCATCGTTAACAGAYACAAATCAGGACTCGAAATATATTCCAATG[T/C]GAGTTACACTACCCGCGAAGGCMGCTCGTGTGATAGTATGAATATTAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025940 Nonsense 104 244 3 6
ENSDART00000143458 Nonsense 104 226 3 5
Genomic Location:
Chromosome 6 (position 52170758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AKCTTGACATTGGTCTTGCCTCCTCTCTCTCAGGGTCTCCTGGAGAAGTA[C/A]CTCATTCCCAACGCTAGCCAGGCAGAGAGCAAAGTCTTCTACCTGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025940 Essential Splice Site 194 244 4 6
ENSDART00000143458 Essential Splice Site 194 226 4 5
Genomic Location:
Chromosome 6 (position 52171206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGAAATCCTCAACACCCCAGAGCAGGCCTGCAGTTTGGCAAAGACGG[T/C]CAGAYGTTTTACTATCTGCTTGTTTAAANTTTTTTTACAACTTAATAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u4nmbkjb