mrpl11

Ensembl ID:
ENSDARG00000013075
ZFIN ID:
ZDB-GENE-040718-294
Description:
39S ribosomal protein L11, mitochondrial [Source:RefSeq peptide;Acc:NP_001002556]
Human Orthologue:
MRPL11
Human Description:
mitochondrial ribosomal protein L11 [Source:HGNC Symbol;Acc:14042]
Mouse Orthologue:
Mrpl11
Mouse Description:
mitochondrial ribosomal protein L11 Gene [Source:MGI Symbol;Acc:MGI:2137215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6348 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019898 Essential Splice Site 158 196 5 6

The following transcripts of ENSDARG00000013075 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 31483786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCATCATCGGTTCAGCCAGATCCCTCGGCATACAAGTAGTGAACGA[G/A]TGAGTGTCCTTCAAACAGTATTCTGCCACATTCATAATAACATTAAAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/it6ci0nn