MMP15 (1 of 2)

Ensembl ID:
ENSDARG00000013072
Description:
matrix metallopeptidase 15 (membrane-inserted) [Source:HGNC Symbol;Acc:7161]
Human Orthologue:
MMP15
Human Description:
matrix metallopeptidase 15 (membrane-inserted) [Source:HGNC Symbol;Acc:7161]
Mouse Orthologue:
Mmp15
Mouse Description:
matrix metallopeptidase 15 Gene [Source:MGI Symbol;Acc:MGI:109320]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21122 Nonsense Mutation detected in F1 DNA During 2014
sa8295 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9518 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020456 Nonsense 112 655 3 10
Genomic Location:
Chromosome 7 (position 66686511)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTGTGGGGTCCCAGACAAGTTTGGGGCTCAAATCAAGACCAATGTA[C/T]GACGGAAACGTTATGCCCTCACTGGCCACAAGTGGGACAAAACTCACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020456 Essential Splice Site 233 655 4 10
Genomic Location:
Chromosome 7 (position 66686046)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTTTGACTCGGACGAACCGTGGACCATTGGATCACAAAACCTACAAG[G/A]TGARTCTTAAGCGTTTTTTTATTGTGTAATATACAGAATTATTAGTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020456 Nonsense 501 655 10 10
Genomic Location:
Chromosome 7 (position 66655493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTAATGCCGTTGCCTAATTTTTYACTTTTTTNGTCTCTGAAAYAGCCTA[C/A]ACATACTTCTACAAGGGTGCAAAATACTGGAAATTTGACAAYCACAGAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h0tjwrig