MMP15 (1 of 2)

Ensembl ID:
ENSDARG00000013072
Description:
matrix metallopeptidase 15 (membrane-inserted) [Source:HGNC Symbol;Acc:7161]
Human Orthologue:
MMP15
Human Description:
matrix metallopeptidase 15 (membrane-inserted) [Source:HGNC Symbol;Acc:7161]
Mouse Orthologue:
Mmp15
Mouse Description:
matrix metallopeptidase 15 Gene [Source:MGI Symbol;Acc:MGI:109320]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21122 Nonsense Mutation detected in F1 DNA During 2016
sa9518 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020456 Nonsense 112 655 3 10
Genomic Location (Zv9):
Chromosome 7 (position 66686511)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64601585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTGTGGGGTCCCAGACAAGTTTGGGGCTCAAATCAAGACCAATGTA[C/T]GACGGAAACGTTATGCCCTCACTGGCCACAAGTGGGACAAAACTCACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020456 Nonsense 501 655 10 10
Genomic Location (Zv9):
Chromosome 7 (position 66655493)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64570567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTAATGCCGTTGCCTAATTTTTYACTTTTTTNGTCTCTGAAAYAGCCTA[C/A]ACATACTTCTACAAGGGTGCAAAATACTGGAAATTTGACAAYCACAGAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link