ascc2

Ensembl ID:
ENSDARG00000013058
ZFIN ID:
ZDB-GENE-040426-1223
Description:
activating signal cointegrator 1 complex subunit 2 [Source:RefSeq peptide;Acc:NP_956736]
Human Orthologue:
ASCC2
Human Description:
activating signal cointegrator 1 complex subunit 2 [Source:HGNC Symbol;Acc:24103]
Mouse Orthologue:
Ascc2
Mouse Description:
activating signal cointegrator 1 complex subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1922702]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10074 Nonsense Available for shipment Available now
sa26429 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa10074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048859 Nonsense 317 768 10 19
ENSDART00000139431   None 243 None 7
ENSDART00000142562   None 192 None 5
Genomic Location:
Chromosome 5 (position 19683871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCACTCTGTCTCAGTTTACAGGAGGACATGTGGAGACGAGTATCTTA[T/A]TCTAGAAAGAAAATGGTGGAGATTGCTCACCTGCTGCTCCARCACGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048859 Essential Splice Site 533 768 14 19
ENSDART00000139431   None 243 None 7
ENSDART00000142562   None 192 None 5
Genomic Location:
Chromosome 5 (position 19680454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATAAACTAGCTCCTTCTCTTGACAAACTAGACCGGGCAATGGCCAGG[T/A]AAAGTATAAGATACAACGATTTATAACACTTTAGAATGGGATCACATTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/261jszwz