ascc2

Ensembl ID:
ENSDARG00000013058
ZFIN ID:
ZDB-GENE-040426-1223
Description:
activating signal cointegrator 1 complex subunit 2 [Source:RefSeq peptide;Acc:NP_956736]
Human Orthologue:
ASCC2
Human Description:
activating signal cointegrator 1 complex subunit 2 [Source:HGNC Symbol;Acc:24103]
Mouse Orthologue:
Ascc2
Mouse Description:
activating signal cointegrator 1 complex subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1922702]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33558 Nonsense Mutation detected in F1 DNA During 2016
sa31421 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10074 Nonsense Available for shipment Available now
sa26429 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048859 Nonsense 177 768 5 19
ENSDART00000139431 Nonsense 177 243 5 7
ENSDART00000142562 Nonsense 177 192 4 5
Genomic Location:
Chromosome 5 (position 19688319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTCCCAAAATTCTGGATCTGTGTGTTCTGTACGGAAAAGGAAATTCC[C/T]AACTGCTACATAAAATGATCGGTACACAAAATCTGTTAATATCACAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048859 Essential Splice Site 244 768 7 19
ENSDART00000139431   None 243 None 7
ENSDART00000142562   None 192 None 5
Genomic Location:
Chromosome 5 (position 19687873)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTCAATGCTAACAGATGCCTAACTGCCATGACCATGCCAGAGGAGG[T/A]AAAATATAATAATAATAAAAAGTAATTATACACACATTAACTGACTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048859 Nonsense 317 768 10 19
ENSDART00000139431   None 243 None 7
ENSDART00000142562   None 192 None 5
Genomic Location:
Chromosome 5 (position 19683871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCACTCTGTCTCAGTTTACAGGAGGACATGTGGAGACGAGTATCTTA[T/A]TCTAGAAAGAAAATGGTGGAGATTGCTCACCTGCTGCTCCARCACGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048859 Essential Splice Site 533 768 14 19
ENSDART00000139431   None 243 None 7
ENSDART00000142562   None 192 None 5
Genomic Location:
Chromosome 5 (position 19680454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATAAACTAGCTCCTTCTCTTGACAAACTAGACCGGGCAATGGCCAGG[T/A]AAAGTATAAGATACAACGATTTATAACACTTTAGAATGGGATCACATTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link