itpk1

Ensembl ID:
ENSDARG00000013056
ZFIN ID:
ZDB-GENE-040426-1953
Description:
Inositol-tetrakisphosphate 1-kinase [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU91]
Human Orthologue:
ITPK1
Human Description:
inositol 1,3,4-triphosphate 5/6 kinase [Source:HGNC Symbol;Acc:6177]
Mouse Orthologue:
Itpk1
Mouse Description:
inositol 1,3,4-triphosphate 5/6 kinase Gene [Source:MGI Symbol;Acc:MGI:2446159]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8954 Nonsense Mutation detected in F1 DNA During 2014
sa17725 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008590 Nonsense 13 396 2 11
Genomic Location:
Chromosome 20 (position 27115228)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGTATTTAGAGATGCAGACGTTCGTGAAAGKAAAGCGAGTTGGATRCTG[G/A]CTCAGTGAGAAGAAGAYTAAAAAACTCAATTTCCAAACCTTCGTGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008590 Nonsense 94 396 5 11
Genomic Location:
Chromosome 20 (position 27097386)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCTCTTTTCAGGACTACATAGACGCTCACCCTGAAACAGTGATTT[T/A]GGACCCTCTTCCGGCCATTCGTACCCTGCTGGACCGRTGCAAATCGTATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/spvfbx1y