itpk1

Ensembl ID:
ENSDARG00000013056
ZFIN ID:
ZDB-GENE-040426-1953
Description:
Inositol-tetrakisphosphate 1-kinase [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU91]
Human Orthologue:
ITPK1
Human Description:
inositol 1,3,4-triphosphate 5/6 kinase [Source:HGNC Symbol;Acc:6177]
Mouse Orthologue:
Itpk1
Mouse Description:
inositol 1,3,4-triphosphate 5/6 kinase Gene [Source:MGI Symbol;Acc:MGI:2446159]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8954 Nonsense Mutation detected in F1 DNA During 2016
sa17725 Nonsense Available for shipment Available now
sa43454 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008590 Nonsense 13 396 2 11
Genomic Location (Zv9):
Chromosome 20 (position 27115228)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27186531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGTATTTAGAGATGCAGACGTTCGTGAAAGKAAAGCGAGTTGGATRCTG[G/A]CTCAGTGAGAAGAAGAYTAAAAAACTCAATTTCCAAACCTTCGTGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008590 Nonsense 94 396 5 11
Genomic Location (Zv9):
Chromosome 20 (position 27097386)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27168689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCTCTTTTCAGGACTACATAGACGCTCACCCTGAAACAGTGATTT[T/A]GGACCCTCTTCCGGCCATTCGTACCCTGCTGGACCGRTGCAAATCGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008590 Essential Splice Site 169 396 8 11
Genomic Location (Zv9):
Chromosome 20 (position 27087296)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27158599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGATACCATGTATATAGAATGTTGTGGAATGTGGTTTCTGTTTAATA[G/A]ATGGCCATCATCTTCAGCGAGGAAGATCTGAAAGACATCAAGCCTCCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link