LOC568482

Ensembl ID:
ENSDARG00000013050
Human Orthologues:
ABCC11, ABCC12
Human Descriptions:
ATP-binding cassette, sub-family C (CFTR/MRP), member 11 [Source:HGNC Symbol;Acc:14639]
ATP-binding cassette, sub-family C (CFTR/MRP), member 12 [Source:HGNC Symbol;Acc:14640]
Mouse Orthologue:
Abcc12
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 12 Gene [Source:MGI Symbol;Acc:MGI:2441679]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18406 Nonsense Available for shipment Available now
sa9287 Nonsense Mutation detected in F1 DNA During 2014
sa21017 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049974 Nonsense 207 1368 5 30
Genomic Location:
Chromosome 7 (position 39572798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTTTTCCTCACKGAGTTYAGCAAGGCATTTTTTGCATCCGTCCTGTG[G/A]GCTGTGAAYTTGMGGACAGCTGTGAGAGTGAAGGGAGCATTCTCCATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049974 Nonsense 818 1368 19 30
Genomic Location:
Chromosome 7 (position 39565004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTTCTTGTGGGATCGMCTGCTTTCAGCAACTGGTGGCTCAGYTACTG[G/A]TTGGACCAGGGATCAGGGGTAAGCACACACACACANNGAAGCACATACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049974 Essential Splice Site 887 1368 20 30
Genomic Location:
Chromosome 7 (position 39563975)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCACTCTGCGTTCCTCTTCCAAACTCCATGACACCATGTTCAAACGG[G/T]TAAGACAAACAGATAAACGATAATTTAATCTTTACTGTCTCTTATTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cx75x3s7