LOC568482

Ensembl ID:
ENSDARG00000013050
Human Orthologues:
ABCC11, ABCC12
Human Descriptions:
ATP-binding cassette, sub-family C (CFTR/MRP), member 11 [Source:HGNC Symbol;Acc:14639]
ATP-binding cassette, sub-family C (CFTR/MRP), member 12 [Source:HGNC Symbol;Acc:14640]
Mouse Orthologue:
Abcc12
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 12 Gene [Source:MGI Symbol;Acc:MGI:2441679]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18406 Nonsense Available for shipment Available now
sa9287 Nonsense Mutation detected in F1 DNA During 2015
sa26997 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa18406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049974 Nonsense 207 1368 5 30
Genomic Location:
Chromosome 7 (position 39572798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTTTTCCTCACKGAGTTYAGCAAGGCATTTTTTGCATCCGTCCTGTG[G/A]GCTGTGAAYTTGMGGACAGCTGTGAGAGTGAAGGGAGCATTCTCCATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049974 Nonsense 818 1368 19 30
Genomic Location:
Chromosome 7 (position 39565004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTTCTTGTGGGATCGMCTGCTTTCAGCAACTGGTGGCTCAGYTACTG[G/A]TTGGACCAGGGATCAGGGGTAAGCACACACACACANNGAAGCACATACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049974 Nonsense 848 1368 20 30
Genomic Location:
Chromosome 7 (position 39564095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATCAAACAGCGGTAATATCTCTGAGAATCCGGACCTGTCGTTCTAC[C/T]AAATGGTTTATGGTGTTATTATCATTGCCATGATCGTGCTGAGTATTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cx75x3s7