mta2

Ensembl ID:
ENSDARG00000013031
ZFIN ID:
ZDB-GENE-030131-4803
Description:
metastasis-associated protein MTA2 [Source:RefSeq peptide;Acc:NP_999860]
Human Orthologue:
MTA2
Human Description:
metastasis associated 1 family, member 2 [Source:HGNC Symbol;Acc:7411]
Mouse Orthologue:
Mta2
Mouse Description:
metastasis-associated gene family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1346340]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40854 Nonsense Mutation detected in F1 DNA During 2017
sa31557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077113 Nonsense 126 631 6 18
ENSDART00000147564 Nonsense 117 622 5 17

The following transcripts of ENSDARG00000013031 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 19177579)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17678962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCACATGGTTCTGTTTCTAACATGTGTTTTTTGTTCTGCAGGACTG[T/A]TTCTTCTACTCTCTGGTGTTTGACCCAGTGCAGAAAACACTGCTGGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077113 Nonsense 402 631 13 18
ENSDART00000147564 Nonsense 393 622 12 17

The following transcripts of ENSDARG00000013031 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 19183112)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17684495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGCAGTGTCGACTATGTTCGTCCTGTTGGATTTACTGGAAGAAATA[C/A]GGTGGTCTGAAGACTCCAACTCAACTAGAGGGCGCCACAAGAGCCAGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link