ints6

Ensembl ID:
ENSDARG00000013025
ZFIN ID:
ZDB-GENE-070906-1
Description:
integrator complex subunit 6 [Source:RefSeq peptide;Acc:NP_001119900]
Human Orthologue:
INTS6
Human Description:
integrator complex subunit 6 [Source:HGNC Symbol;Acc:14879]
Mouse Orthologue:
Ints6
Mouse Description:
integrator complex subunit 6 Gene [Source:MGI Symbol;Acc:MGI:1202397]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14648 Nonsense Available for shipment Available now
sa18202 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009932 Nonsense 98 872 3 18
ENSDART00000138470 Nonsense 98 854 3 18
Genomic Location:
Chromosome 9 (position 24859932)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGTTGGACTGACATCGTTTGGCCAAGCTTTAAGGACAGCTTTTGATT[T/A]GCTCAATCTTAAYAGATTAGTTTCAGGGATAGACAACTATGGACAGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009932 Nonsense 163 872 5 18
ENSDART00000138470 Nonsense 163 854 5 18
Genomic Location:
Chromosome 9 (position 24862577)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCGTTAACAACACCATTACCTGGCAGTGAACTGACCAAAGAGCCCTTT[C/T]GATGGGACCAGCGACTCTTCTCTTTAGTGCTGCGTGTTCCAGGCCATGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ti6rvbtq