dtnb

Ensembl ID:
ENSDARG00000013020
ZFIN ID:
ZDB-GENE-070117-3
Description:
dystrobrevin beta [Source:RefSeq peptide;Acc:NP_001074042]
Human Orthologue:
DTNB
Human Description:
dystrobrevin, beta [Source:HGNC Symbol;Acc:3058]
Mouse Orthologue:
Dtnb
Mouse Description:
dystrobrevin, beta Gene [Source:MGI Symbol;Acc:MGI:1203728]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36472 Essential Splice Site Available for shipment Available now
sa28896 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6489 Nonsense Mutation detected in F1 DNA During 2017
sa8534 Nonsense Mutation detected in F1 DNA During 2017
sa42978 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104020 Essential Splice Site 50 568 3 17
ENSDART00000145669 Essential Splice Site 50 568 5 19
Genomic Location (Zv9):
Chromosome 17 (position 37316532)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37201429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGAAACACTGTTTTGGATCATCTCACCTGTTTACTTCTCCTGTCGCA[G/A]TTCACCTAGTGGATGTGTGGAACATGATCGAAGCTTTTCGCGACAACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104020 Essential Splice Site 293 568 8 17
ENSDART00000145669 Essential Splice Site 293 568 10 19
Genomic Location (Zv9):
Chromosome 17 (position 37301771)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37186668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTAACAGCTTTTTTAAACTTTTCAATCTTGTTTCTTTCTCGCTATAC[A/T]GAAGTCTCCAGCAAAGAAGCTCAGCCACGCCATCAGTAAATCTCTGGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104020 Nonsense 365 568 10 17
ENSDART00000145669 Nonsense 365 568 12 19
Genomic Location (Zv9):
Chromosome 17 (position 37255728)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37140625
KASP Assay ID:
554-4660.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTTGCTCATAATCAGTAATCCACTTCTCTAATYATTTTGTCTTTCAG[C/T]AATGCCCTCCGTCTGATCTAAGCTTCAACTTTGATGCTAATAAGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104020 Nonsense 428 568 11 17
ENSDART00000145669 Nonsense 428 568 13 19
Genomic Location (Zv9):
Chromosome 17 (position 37254142)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37139039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCRACCCCTGAAAAAGCCCAGCAGAAYCCRACACTWCTGGCAGAGCTA[C/T]GACTGCTGCGGTATGATGACACACACTTGAGGCACTATTCACAAAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104020 Essential Splice Site 565 568 15 17
ENSDART00000145669 Essential Splice Site 565 568 17 19
Genomic Location (Zv9):
Chromosome 17 (position 37240871)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37125768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGGCTTGAGGAAGAGGAAGAGAACATGCGAAATGGACGGGAGAAGAG[T/G]GAGTCGCAAAGGCCATTTCCCTTTCTTTCAGAATGACAACTGAAATAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link